ID: 901782827

View in Genome Browser
Species Human (GRCh38)
Location 1:11605349-11605371
Sequence TCCAAAAATGTCTCCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901782822_901782827 6 Left 901782822 1:11605320-11605342 CCCATGAGATGTCAGTAGCATCT No data
Right 901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG No data
901782823_901782827 5 Left 901782823 1:11605321-11605343 CCATGAGATGTCAGTAGCATCTC No data
Right 901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG No data
901782821_901782827 12 Left 901782821 1:11605314-11605336 CCTCTGCCCATGAGATGTCAGTA No data
Right 901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901782827 Original CRISPR TCCAAAAATGTCTCCAGTCA TGG Intergenic
No off target data available for this crispr