ID: 901783184

View in Genome Browser
Species Human (GRCh38)
Location 1:11608143-11608165
Sequence TCCTCTCCATGAAGCCCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783184_901783191 -2 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783191 1:11608164-11608186 GAGGGAAAGAAGGAACAGGGAGG No data
901783184_901783192 6 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783192 1:11608172-11608194 GAAGGAACAGGGAGGACCCCAGG No data
901783184_901783189 -6 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783189 1:11608160-11608182 AGAGGAGGGAAAGAAGGAACAGG No data
901783184_901783197 23 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783197 1:11608189-11608211 CCCAGGCCTGAGCCTGTGGGTGG No data
901783184_901783194 20 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783194 1:11608186-11608208 GACCCCAGGCCTGAGCCTGTGGG No data
901783184_901783190 -5 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783190 1:11608161-11608183 GAGGAGGGAAAGAAGGAACAGGG No data
901783184_901783193 19 Left 901783184 1:11608143-11608165 CCCACGGGGCTTCATGGAGAGGA No data
Right 901783193 1:11608185-11608207 GGACCCCAGGCCTGAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783184 Original CRISPR TCCTCTCCATGAAGCCCCGT GGG (reversed) Intergenic