ID: 901783919

View in Genome Browser
Species Human (GRCh38)
Location 1:11612126-11612148
Sequence AGCTGCCCAGGCCCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783919_901783932 30 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783932 1:11612179-11612201 AGAGGAGAGAGAAGAAGACAGGG No data
901783919_901783926 -10 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783926 1:11612139-11612161 CTGGGCAGCTAGCCAGGGTGGGG No data
901783919_901783928 12 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data
901783919_901783931 29 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783919 Original CRISPR AGCTGCCCAGGCCCTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr