ID: 901783920

View in Genome Browser
Species Human (GRCh38)
Location 1:11612127-11612149
Sequence TAGCTGCCCAGGCCCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783920_901783928 11 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data
901783920_901783931 28 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783920_901783932 29 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783932 1:11612179-11612201 AGAGGAGAGAGAAGAAGACAGGG No data
901783920_901783933 30 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783920 Original CRISPR TAGCTGCCCAGGCCCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr