ID: 901783924

View in Genome Browser
Species Human (GRCh38)
Location 1:11612138-11612160
Sequence CCCACCCTGGCTAGCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783924_901783933 19 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783924_901783932 18 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783932 1:11612179-11612201 AGAGGAGAGAGAAGAAGACAGGG No data
901783924_901783934 23 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783924_901783931 17 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783924_901783928 0 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783924 Original CRISPR CCCACCCTGGCTAGCTGCCC AGG (reversed) Intergenic
No off target data available for this crispr