ID: 901783927

View in Genome Browser
Species Human (GRCh38)
Location 1:11612151-11612173
Sequence CACAGGCTGTGGCCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783927_901783940 30 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783940 1:11612204-11612226 AGGAAGTAGAGGGGGAATAAGGG No data
901783927_901783938 22 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783938 1:11612196-11612218 ACAGGGGAAGGAAGTAGAGGGGG No data
901783927_901783939 29 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data
901783927_901783936 20 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783936 1:11612194-11612216 AGACAGGGGAAGGAAGTAGAGGG No data
901783927_901783933 6 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783927_901783931 4 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783927_901783932 5 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783932 1:11612179-11612201 AGAGGAGAGAGAAGAAGACAGGG No data
901783927_901783934 10 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783927_901783935 19 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783935 1:11612193-11612215 AAGACAGGGGAAGGAAGTAGAGG No data
901783927_901783937 21 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783927 Original CRISPR CACAGGCTGTGGCCCCACCC TGG (reversed) Intergenic
No off target data available for this crispr