ID: 901783928

View in Genome Browser
Species Human (GRCh38)
Location 1:11612161-11612183
Sequence GCCACAGCCTGTGAGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783920_901783928 11 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data
901783919_901783928 12 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data
901783924_901783928 0 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783928 1:11612161-11612183 GCCACAGCCTGTGAGCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783928 Original CRISPR GCCACAGCCTGTGAGCACAG AGG Intergenic
No off target data available for this crispr