ID: 901783929

View in Genome Browser
Species Human (GRCh38)
Location 1:11612162-11612184
Sequence TCCTCTGTGCTCACAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783929_901783933 -5 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783929_901783940 19 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783940 1:11612204-11612226 AGGAAGTAGAGGGGGAATAAGGG No data
901783929_901783931 -7 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783929_901783942 25 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783942 1:11612210-11612232 TAGAGGGGGAATAAGGGAAAGGG No data
901783929_901783936 9 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783936 1:11612194-11612216 AGACAGGGGAAGGAAGTAGAGGG No data
901783929_901783935 8 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783935 1:11612193-11612215 AAGACAGGGGAAGGAAGTAGAGG No data
901783929_901783937 10 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data
901783929_901783943 26 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783943 1:11612211-11612233 AGAGGGGGAATAAGGGAAAGGGG No data
901783929_901783934 -1 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783929_901783932 -6 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783932 1:11612179-11612201 AGAGGAGAGAGAAGAAGACAGGG No data
901783929_901783941 24 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783941 1:11612209-11612231 GTAGAGGGGGAATAAGGGAAAGG No data
901783929_901783938 11 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783938 1:11612196-11612218 ACAGGGGAAGGAAGTAGAGGGGG No data
901783929_901783939 18 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data
901783929_901783944 30 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783944 1:11612215-11612237 GGGGAATAAGGGAAAGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783929 Original CRISPR TCCTCTGTGCTCACAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr