ID: 901783930

View in Genome Browser
Species Human (GRCh38)
Location 1:11612168-11612190
Sequence TCTCTCTCCTCTGTGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783930_901783944 24 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783944 1:11612215-11612237 GGGGAATAAGGGAAAGGGGTAGG No data
901783930_901783946 30 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783946 1:11612221-11612243 TAAGGGAAAGGGGTAGGGCCTGG No data
901783930_901783942 19 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783942 1:11612210-11612232 TAGAGGGGGAATAAGGGAAAGGG No data
901783930_901783943 20 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783943 1:11612211-11612233 AGAGGGGGAATAAGGGAAAGGGG No data
901783930_901783945 25 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783945 1:11612216-11612238 GGGAATAAGGGAAAGGGGTAGGG No data
901783930_901783936 3 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783936 1:11612194-11612216 AGACAGGGGAAGGAAGTAGAGGG No data
901783930_901783941 18 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783941 1:11612209-11612231 GTAGAGGGGGAATAAGGGAAAGG No data
901783930_901783935 2 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783935 1:11612193-11612215 AAGACAGGGGAAGGAAGTAGAGG No data
901783930_901783934 -7 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783930_901783940 13 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783940 1:11612204-11612226 AGGAAGTAGAGGGGGAATAAGGG No data
901783930_901783938 5 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783938 1:11612196-11612218 ACAGGGGAAGGAAGTAGAGGGGG No data
901783930_901783939 12 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data
901783930_901783937 4 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783930 Original CRISPR TCTCTCTCCTCTGTGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr