ID: 901783931

View in Genome Browser
Species Human (GRCh38)
Location 1:11612178-11612200
Sequence CAGAGGAGAGAGAAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783919_901783931 29 Left 901783919 1:11612126-11612148 CCCAGCAGAGGGCCTGGGCAGCT No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783927_901783931 4 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783920_901783931 28 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783924_901783931 17 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data
901783929_901783931 -7 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783931 Original CRISPR CAGAGGAGAGAGAAGAAGAC AGG Intergenic
No off target data available for this crispr