ID: 901783933

View in Genome Browser
Species Human (GRCh38)
Location 1:11612180-11612202
Sequence GAGGAGAGAGAAGAAGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783920_901783933 30 Left 901783920 1:11612127-11612149 CCAGCAGAGGGCCTGGGCAGCTA No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783927_901783933 6 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783924_901783933 19 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data
901783929_901783933 -5 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783933 1:11612180-11612202 GAGGAGAGAGAAGAAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783933 Original CRISPR GAGGAGAGAGAAGAAGACAG GGG Intergenic
No off target data available for this crispr