ID: 901783934

View in Genome Browser
Species Human (GRCh38)
Location 1:11612184-11612206
Sequence AGAGAGAAGAAGACAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783927_901783934 10 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783929_901783934 -1 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783930_901783934 -7 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data
901783924_901783934 23 Left 901783924 1:11612138-11612160 CCTGGGCAGCTAGCCAGGGTGGG No data
Right 901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783934 Original CRISPR AGAGAGAAGAAGACAGGGGA AGG Intergenic
No off target data available for this crispr