ID: 901783937

View in Genome Browser
Species Human (GRCh38)
Location 1:11612195-11612217
Sequence GACAGGGGAAGGAAGTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783930_901783937 4 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data
901783927_901783937 21 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data
901783929_901783937 10 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783937 1:11612195-11612217 GACAGGGGAAGGAAGTAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783937 Original CRISPR GACAGGGGAAGGAAGTAGAG GGG Intergenic
No off target data available for this crispr