ID: 901783939

View in Genome Browser
Species Human (GRCh38)
Location 1:11612203-11612225
Sequence AAGGAAGTAGAGGGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783927_901783939 29 Left 901783927 1:11612151-11612173 CCAGGGTGGGGCCACAGCCTGTG No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data
901783930_901783939 12 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data
901783929_901783939 18 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783939 1:11612203-11612225 AAGGAAGTAGAGGGGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783939 Original CRISPR AAGGAAGTAGAGGGGGAATA AGG Intergenic
No off target data available for this crispr