ID: 901783941

View in Genome Browser
Species Human (GRCh38)
Location 1:11612209-11612231
Sequence GTAGAGGGGGAATAAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783930_901783941 18 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783941 1:11612209-11612231 GTAGAGGGGGAATAAGGGAAAGG No data
901783929_901783941 24 Left 901783929 1:11612162-11612184 CCACAGCCTGTGAGCACAGAGGA No data
Right 901783941 1:11612209-11612231 GTAGAGGGGGAATAAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783941 Original CRISPR GTAGAGGGGGAATAAGGGAA AGG Intergenic
No off target data available for this crispr