ID: 901783945

View in Genome Browser
Species Human (GRCh38)
Location 1:11612216-11612238
Sequence GGGAATAAGGGAAAGGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783930_901783945 25 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783945 1:11612216-11612238 GGGAATAAGGGAAAGGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783945 Original CRISPR GGGAATAAGGGAAAGGGGTA GGG Intergenic
No off target data available for this crispr