ID: 901783946

View in Genome Browser
Species Human (GRCh38)
Location 1:11612221-11612243
Sequence TAAGGGAAAGGGGTAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901783930_901783946 30 Left 901783930 1:11612168-11612190 CCTGTGAGCACAGAGGAGAGAGA No data
Right 901783946 1:11612221-11612243 TAAGGGAAAGGGGTAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901783946 Original CRISPR TAAGGGAAAGGGGTAGGGCC TGG Intergenic
No off target data available for this crispr