ID: 901784642

View in Genome Browser
Species Human (GRCh38)
Location 1:11616757-11616779
Sequence CTCCCTCAGGGGGTCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901784642_901784659 28 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784659 1:11616808-11616830 AGAGAAAACTGGGGCACAGAGGG No data
901784642_901784650 5 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784650 1:11616785-11616807 GTTAGCATCCCCCACTTGATAGG No data
901784642_901784655 17 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784655 1:11616797-11616819 CACTTGATAGGAGAGAAAACTGG No data
901784642_901784657 19 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784657 1:11616799-11616821 CTTGATAGGAGAGAAAACTGGGG No data
901784642_901784656 18 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784656 1:11616798-11616820 ACTTGATAGGAGAGAAAACTGGG No data
901784642_901784658 27 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784658 1:11616807-11616829 GAGAGAAAACTGGGGCACAGAGG No data
901784642_901784660 29 Left 901784642 1:11616757-11616779 CCACTGAGGACCCCCTGAGGGAG No data
Right 901784660 1:11616809-11616831 GAGAAAACTGGGGCACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901784642 Original CRISPR CTCCCTCAGGGGGTCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr