ID: 901785001

View in Genome Browser
Species Human (GRCh38)
Location 1:11618754-11618776
Sequence CCTATAACTCATTACCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901785001_901785012 23 Left 901785001 1:11618754-11618776 CCTTTTGGGTAATGAGTTATAGG No data
Right 901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG No data
901785001_901785008 -4 Left 901785001 1:11618754-11618776 CCTTTTGGGTAATGAGTTATAGG No data
Right 901785008 1:11618773-11618795 TAGGGGTTCGGGGCTACCATTGG No data
901785001_901785010 16 Left 901785001 1:11618754-11618776 CCTTTTGGGTAATGAGTTATAGG No data
Right 901785010 1:11618793-11618815 TGGCCTTCTTCCCTAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901785001 Original CRISPR CCTATAACTCATTACCCAAA AGG (reversed) Intergenic
No off target data available for this crispr