ID: 901785012

View in Genome Browser
Species Human (GRCh38)
Location 1:11618800-11618822
Sequence CTTCCCTAACACGTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901785001_901785012 23 Left 901785001 1:11618754-11618776 CCTTTTGGGTAATGAGTTATAGG No data
Right 901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901785012 Original CRISPR CTTCCCTAACACGTGGAGAA AGG Intergenic
No off target data available for this crispr