ID: 901786751

View in Genome Browser
Species Human (GRCh38)
Location 1:11629823-11629845
Sequence CTGCGGTGCTGTGTGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901786737_901786751 20 Left 901786737 1:11629780-11629802 CCCCCTGGGACCCTGGAAAGTCT No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786743_901786751 10 Left 901786743 1:11629790-11629812 CCCTGGAAAGTCTCTCCGGGCCT No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786749_901786751 -10 Left 901786749 1:11629810-11629832 CCTTCGGACAGGCCTGCGGTGCT No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786747_901786751 -5 Left 901786747 1:11629805-11629827 CCGGGCCTTCGGACAGGCCTGCG No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786739_901786751 18 Left 901786739 1:11629782-11629804 CCCTGGGACCCTGGAAAGTCTCT No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786744_901786751 9 Left 901786744 1:11629791-11629813 CCTGGAAAGTCTCTCCGGGCCTT No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786740_901786751 17 Left 901786740 1:11629783-11629805 CCTGGGACCCTGGAAAGTCTCTC No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data
901786738_901786751 19 Left 901786738 1:11629781-11629803 CCCCTGGGACCCTGGAAAGTCTC No data
Right 901786751 1:11629823-11629845 CTGCGGTGCTGTGTGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901786751 Original CRISPR CTGCGGTGCTGTGTGAGAGC AGG Intergenic