ID: 901789460

View in Genome Browser
Species Human (GRCh38)
Location 1:11646767-11646789
Sequence CCGGAGCCTGCACTGGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901789460_901789467 13 Left 901789460 1:11646767-11646789 CCATAGCCCAGTGCAGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 222
Right 901789467 1:11646803-11646825 CACCCCATCTCCTCTTAACCTGG 0: 1
1: 0
2: 1
3: 18
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901789460 Original CRISPR CCGGAGCCTGCACTGGGCTA TGG (reversed) Intergenic
900130300 1:1084557-1084579 CCGGACGCTGCACTGGGCTGAGG - Intronic
900205985 1:1432108-1432130 CAGGGGCCTGGACTGGGATAGGG - Intergenic
900618445 1:3576125-3576147 CCGAGGCCTGCACTGGGCCGGGG + Intronic
900957553 1:5896224-5896246 CCCGAGCACACACTGGGCTACGG + Intronic
901789460 1:11646767-11646789 CCGGAGCCTGCACTGGGCTATGG - Intergenic
903116462 1:21182518-21182540 ACAGAGGCTGCACTGGGCTCTGG - Intergenic
904357936 1:29953477-29953499 ATGGAGCCTGCAGTGGTCTAAGG - Intergenic
905434253 1:37946204-37946226 CCTGAGCCTGCCCTGGCCTTGGG - Intronic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
913330445 1:117662940-117662962 CCTGAGGCTGCACAGGGCAATGG - Intergenic
914941115 1:152023676-152023698 CCAGGCCCTGCTCTGGGCTAGGG + Intergenic
914968836 1:152288230-152288252 CCGGAGCCTGTTGTGGGGTAGGG - Intergenic
915005442 1:152630680-152630702 CTGGGGCCTGCCCTGGGCTGGGG + Intergenic
922750056 1:228066061-228066083 CCTGAGCCTGGACTGAGCTGAGG + Intergenic
1063591518 10:7400088-7400110 CCAGAGCCTGCACTGGGAAATGG + Intronic
1064103439 10:12482183-12482205 CAGGAGCCAGCACTATGCTACGG - Intronic
1065118647 10:22506801-22506823 TCGGAGCCTGCTCTGGGATGGGG - Intergenic
1066436432 10:35400255-35400277 CCGCCCCCTGCACTGTGCTAGGG - Intronic
1067341528 10:45409264-45409286 TCGGAGCCTGCTCTGGTTTAGGG + Intronic
1070783817 10:79151799-79151821 CTGGAGGCTGCAGTGGGCTGCGG + Intronic
1071598216 10:86943070-86943092 CCAGCGCCTGCACTTGGCTCCGG + Exonic
1072109087 10:92300958-92300980 CCGGAGGCTGCAGTGAGCCAAGG - Intronic
1075534182 10:123256332-123256354 TTGGAGCCTGCAGTGAGCTATGG - Intergenic
1075778618 10:125003296-125003318 CCGGGGCCTGCACTGACCTTGGG - Intronic
1075805706 10:125187326-125187348 CCAGAGCCAGCACTGGCCTTGGG + Intergenic
1076581276 10:131513571-131513593 ACTGAGGCTGCACAGGGCTAGGG - Intergenic
1076990013 11:267896-267918 CTGGAGCTTGCACTGTGCAACGG + Intergenic
1077913729 11:6597154-6597176 TAGGAGCCTGCACTGGGAAAGGG + Exonic
1078182237 11:9021752-9021774 ACGGAGCCTGTCCTGGGCCAAGG - Intronic
1079376229 11:19894584-19894606 CCTGACCCTGCCCTGGGCAAAGG + Intronic
1081554773 11:44148473-44148495 CTGGAGCATGTGCTGGGCTATGG - Intronic
1083159292 11:60844782-60844804 CCCTACCCTGCACTGGGCTCTGG - Intronic
1083684522 11:64368504-64368526 CGGGAGCCTGCGCTGGGCCAGGG + Exonic
1083946764 11:65927950-65927972 CCGGGCCCTGCTCTGGGCTTGGG + Intergenic
1084385155 11:68839206-68839228 CCGGAGCCTGCGCGGGCCAAGGG - Intronic
1084757319 11:71248080-71248102 CCAGAGCCTGCCCTGGGTTTAGG - Intronic
1084901248 11:72311559-72311581 CCTGAGCCTGCGCTGTACTATGG + Intronic
1086253087 11:84840827-84840849 CCAGAGCCTGTCCTGGGGTAGGG + Intronic
1087187002 11:95210204-95210226 CCGGAGCCTGTAGGGGGTTAGGG + Intronic
1089401760 11:118168489-118168511 CCGGCCCCGGCACTGCGCTAGGG - Intronic
1091850913 12:3696240-3696262 CCGGGCCCTGCACTAGGCAATGG + Intronic
1092502895 12:9065355-9065377 CTGGAGCCTGCAGTGGGCAGGGG - Intergenic
1094126895 12:27032869-27032891 CCTGAGCCAGCACTGGACTGTGG + Intronic
1096024590 12:48350363-48350385 CGGGAGCCTGCTCAGGGGTAAGG + Exonic
1097440245 12:59599131-59599153 CCAGACACTGTACTGGGCTATGG - Intronic
1099733707 12:86539178-86539200 CCGGAGCCTGTAGTGGGGTCGGG - Intronic
1101351155 12:103930656-103930678 CCGGGGCCTGCGGTGGGCCAAGG + Intronic
1101716418 12:107317351-107317373 CTGGATTCTACACTGGGCTAGGG - Intergenic
1102027875 12:109723732-109723754 CAGGAACCTGCTCTGGGCTTGGG - Intronic
1104444496 12:128822914-128822936 TCGGAGGCTGCAGTGAGCTAGGG - Intronic
1104879735 12:132062271-132062293 CCGGGGTCTGCACTGGGGTCAGG - Exonic
1105363608 13:19744038-19744060 GCGGAGGCTGCAGTGGGCTGAGG + Intronic
1106277358 13:28224684-28224706 CTGGAGGCTGCAGTGAGCTACGG - Intronic
1108615588 13:52128974-52128996 CCGGAGCCGCCACAGGGCTTCGG - Intronic
1111282442 13:86044540-86044562 CCGGGGCCTGTCATGGGCTAGGG + Intergenic
1113440781 13:110326519-110326541 CTGGGGCCTGCAATGTGCTAAGG - Intronic
1113562811 13:111296770-111296792 TCAGAGCCTGTACTGTGCTAAGG + Intronic
1113923959 13:113930080-113930102 CGGCAGCCAGCACTGGGCTGTGG + Intergenic
1118863362 14:69683071-69683093 CTGGAGCCTGAAGGGGGCTAGGG + Intronic
1119272008 14:73314580-73314602 CAGGAGCCTGGAGTGGGTTAAGG - Intronic
1122088799 14:99324477-99324499 CCGGAGCCTGCACAGCTCTGAGG - Intergenic
1122202463 14:100130830-100130852 CCGGAGCCTCTACTGGGCCTGGG + Intronic
1122771174 14:104098622-104098644 CCGGAGCCTGCAGGGGCCTGGGG - Intronic
1122772417 14:104103339-104103361 CCGCAGCGTGCACGGGGCTGTGG - Intronic
1123068869 14:105631374-105631396 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123073025 14:105651332-105651354 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123092947 14:105750102-105750124 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123107518 14:105849657-105849679 GGGGAGTCTGCACTGGGCTGGGG - Intergenic
1128676972 15:69617185-69617207 CCGGGGCCTGCTGTGGGGTAGGG - Intergenic
1128809772 15:70562263-70562285 CCGGAGCCTGACTTGGGTTATGG + Intergenic
1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG + Intronic
1129339003 15:74872940-74872962 CCGGAGGCTGGGCTGTGCTAGGG - Intronic
1132329489 15:101002014-101002036 TCGGAGTCTGCCCTGGGCTGGGG + Intronic
1132683881 16:1154250-1154272 CCGGAGCCGGCCCTGGGGAAGGG - Intronic
1132903127 16:2268950-2268972 CCGGACCCTGCACCGGCCGATGG - Intergenic
1134005696 16:10817925-10817947 CTGGAGCCTGCATTGGGAGAGGG - Intronic
1136561575 16:31042269-31042291 CCGGGCTCTGGACTGGGCTAGGG + Intronic
1139671824 16:68497427-68497449 CCCCAGGCTGCCCTGGGCTAAGG - Intergenic
1140880183 16:79191119-79191141 GCGGAGGCTGCACTGAGCCAAGG - Intronic
1141429971 16:83966377-83966399 CGGAACCCTGCACTGGGCTGGGG + Intergenic
1141471858 16:84244076-84244098 CTGGTGGCTGCATTGGGCTATGG + Intergenic
1141802329 16:86318506-86318528 CCGGACACTGCACTGGGCACTGG - Intergenic
1142256975 16:89018761-89018783 CCGGAGGCTGGGCTGGGCTCAGG - Intergenic
1144516026 17:15917937-15917959 CTCGAGCCTGCACTGGGCCCGGG + Intergenic
1146003896 17:29148936-29148958 CCGGAGCCTGGGCGGGGCCAAGG + Intronic
1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG + Intergenic
1148124950 17:45231671-45231693 CTGGAGCCTGCAGTGGGGTGGGG + Intronic
1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG + Intergenic
1148591022 17:48816936-48816958 CTGGAGCCAGCACCGGGCTTTGG + Intronic
1152717113 17:81905503-81905525 CCGGGGCCTGTGCTGGGCTGTGG - Intronic
1203165437 17_GL000205v2_random:88977-88999 CCCCAGCATGCACTGGGCTCAGG - Intergenic
1154201187 18:12301880-12301902 CCAGGGCCTCCACTGGGCTTTGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156517480 18:37693098-37693120 CCGGAGCCTGTCATGGGGTAGGG - Intergenic
1158276005 18:55768263-55768285 CAGGAGCCTCCACTGGGCTTTGG + Intergenic
1158629751 18:59101544-59101566 CCGATGCCTGCCCAGGGCTAAGG + Intergenic
1158727659 18:59988736-59988758 TAGGAGCCTGCAGTGAGCTATGG + Intergenic
1160203828 18:76816783-76816805 TCTGCTCCTGCACTGGGCTATGG + Exonic
1160239665 18:77113973-77113995 CAGGAGCCAGCCCTGGGCTAGGG + Intronic
1161151405 19:2712030-2712052 CCCCAGCCTGCTCTGGGTTAGGG + Intergenic
1161593149 19:5137713-5137735 GGGGAGCCTGCCCTGGGCTGAGG + Intronic
1161607772 19:5224306-5224328 GTAGAGCCGGCACTGGGCTAGGG + Intronic
1162802393 19:13118562-13118584 CCGCAGCCTGCACTGTGCCCGGG + Intronic
1163000165 19:14362218-14362240 GAGGAGTCTGCACTGGGCCAAGG + Intergenic
1163728060 19:18933530-18933552 CTGCTGCCTGCACTGGGCTGCGG - Intronic
1164399155 19:27890907-27890929 CCTGTGCCTGCACTGAGCTAGGG - Intergenic
1164446243 19:28319876-28319898 CAGGAGGCTGCAGTGAGCTATGG - Intergenic
1164538983 19:29108099-29108121 CTGGAGACTGCACAGGGCCAGGG - Intergenic
1168588374 19:57613122-57613144 GCGGAGCCTGCAGTGAGCTATGG + Intergenic
925048949 2:796304-796326 CCGCATCCTGCACTGCGCTGCGG + Intergenic
926120178 2:10237514-10237536 CTGGAGCCCGCCCTGGGCTCTGG + Intergenic
926120191 2:10237554-10237576 CTGGAGCCCGCCCTGGGCTCTGG + Intergenic
926954544 2:18280191-18280213 GCGGAGCTTGCAGTGAGCTAAGG - Intronic
927259155 2:21069510-21069532 CCGGGGCCTGCCATGGGGTAGGG - Intergenic
927515610 2:23670124-23670146 CCAGAGGCTGCACAGGGCTCTGG + Intronic
928964822 2:36966314-36966336 CGGGAGACTGTACTGGGCTCGGG + Exonic
929041517 2:37749295-37749317 GAGGAGGCTGCACTGAGCTAAGG + Intergenic
931953292 2:67389521-67389543 CCTAGGCCTGCACTTGGCTAGGG + Intergenic
932188549 2:69719333-69719355 CAGGAGGCTGCAATGTGCTATGG - Intronic
932520780 2:72409704-72409726 CCGGGGCCTGCTGTGGGGTAGGG + Intronic
932714108 2:74089169-74089191 CCGGTGACTGCCCAGGGCTAGGG - Intronic
935012798 2:99151393-99151415 GCGGAGGCTGCACTGAGCTGAGG + Exonic
935174938 2:100641481-100641503 CAGGAGCAGGCACTGGGCTGGGG + Intergenic
935535360 2:104286988-104287010 CCGGAGCCTGCAGAGAGCTGTGG + Intergenic
937910701 2:127074209-127074231 CAGGAGGCTGCAGTGGGCTTGGG - Intronic
938573172 2:132581299-132581321 CAGGAGTCTTCACAGGGCTATGG + Intronic
938618019 2:133019901-133019923 TCGGAGCCTGCACACTGCTATGG + Intronic
938830280 2:135043312-135043334 CAGGAAACTGCACTGAGCTAAGG - Intronic
940769670 2:157826584-157826606 GTGGAGGCTGCAGTGGGCTATGG + Intronic
947435425 2:230068417-230068439 CCCGAGCCTGCCTTGGGCTGGGG + Intronic
948454754 2:238099816-238099838 ACGGGGCCTGCAATGGGCTCAGG - Intergenic
948827582 2:240580206-240580228 CCGGAGGCTGCATTGGACAAGGG - Exonic
1170131503 20:13025564-13025586 CTGGTGCCTGCACTGTTCTAAGG - Intronic
1170570595 20:17630055-17630077 CCAGAGACTGCACGGGGCTTTGG - Intronic
1171480446 20:25451719-25451741 CCGGGGCCTGTCCTGGGGTAGGG - Intronic
1172389612 20:34558335-34558357 CCGGCGCCTTCACGGGGCTTAGG - Intronic
1173759567 20:45547565-45547587 CCCTAGGCTGCACTGGGCTGGGG + Intronic
1174626243 20:51916771-51916793 GCGGAGGCTGCAGTGGGCTGTGG + Intergenic
1174658528 20:52191538-52191560 CCGGAGCGCGCACTGGGCCCCGG + Intronic
1174997023 20:55581434-55581456 CCGGGGCCTGAGCTGGGGTAGGG + Intergenic
1175848887 20:62076310-62076332 GCGGAGCTTGCACTGAGCTGAGG + Intergenic
1176285754 21:5018591-5018613 ACGGAGGCTGCAGTGAGCTATGG - Intergenic
1176336249 21:5602475-5602497 CCCCAGCATGCACTGGGCTCAGG + Intergenic
1176369439 21:6053598-6053620 CCGGGGCCTCCTCTGGGCTAGGG - Intergenic
1176391508 21:6218473-6218495 CCCCAGCATGCACTGGGCTCAGG - Intergenic
1176406315 21:6370102-6370124 CCCCAGCATGCACTGGGCTCAGG + Intergenic
1176469911 21:7097701-7097723 CCCCAGCATGCACTGGGCTCAGG + Intergenic
1176493472 21:7479479-7479501 CCCCAGCATGCACTGGGCTCAGG + Intergenic
1176507170 21:7658904-7658926 CCCCAGCATGCACTGGGCTCAGG - Intergenic
1179754080 21:43484943-43484965 CCGGGGCCTCCTCTGGGCTAGGG + Intergenic
1179871427 21:44244884-44244906 ACGGAGGCTGCAGTGAGCTATGG + Intergenic
1181046814 22:20218528-20218550 GTGGAGCTTGCACTGGGCTCAGG - Intergenic
1181235745 22:21446834-21446856 CCGGAGCCTCCACTGGACCCAGG - Exonic
1183475045 22:38031518-38031540 CCAGGTCCTGCACTGGGCTCTGG - Intronic
1184775626 22:46621451-46621473 CCTGCGCCTGCACCGGGGTAGGG - Intronic
1184775650 22:46621523-46621545 CCTGCGCCTGCACCGGGGTAGGG - Intronic
1184775674 22:46621595-46621617 CCTGCGCCTGCACCGGGGTAGGG - Intronic
1184775697 22:46621667-46621689 CCTGTGCCTGCACCGGGGTAGGG - Intronic
1184775720 22:46621739-46621761 CCTGCGCCTGCACCGGGGTAGGG - Intronic
1185085301 22:48737690-48737712 CCTGAGGCTGCACTGGCCTTGGG - Intronic
1185419672 22:50728439-50728461 CCAGACCCTGCTCTGGGCTCCGG + Intergenic
1203293768 22_KI270736v1_random:20850-20872 GAGGAGGCTGCACTGAGCTAAGG + Intergenic
950449226 3:13056237-13056259 CCCAAGCCTGTACTGGACTAAGG - Intronic
950744784 3:15078690-15078712 GCGGAGGTTGCAGTGGGCTAAGG + Intronic
951053195 3:18118169-18118191 CCGGAGCCTGTCCTGGGGTGGGG + Intronic
953850731 3:46463977-46463999 GTGGAGGCTGCACTGGGCTGGGG + Intronic
953879964 3:46686488-46686510 CCGGGACCAGGACTGGGCTAGGG - Intronic
957199700 3:77116771-77116793 CCAAAGGCTGCCCTGGGCTAAGG - Intronic
958473241 3:94548801-94548823 CTGCAGCCTCTACTGGGCTATGG - Intergenic
959569146 3:107864291-107864313 GCGGAGCTTGCACTGAGCCAAGG - Intergenic
960946051 3:122967504-122967526 CAGGAGTCTGCACTGGGTTAAGG - Intronic
961623802 3:128245213-128245235 CATGAGCCTGCCATGGGCTATGG + Intronic
963004336 3:140711905-140711927 CCAATGCCTGCACTGGACTAGGG - Intergenic
963746946 3:149134138-149134160 CAGGGGCCTGCACTGGGCCACGG + Intronic
968541218 4:1169358-1169380 CCCAAGCCTGCACTGGGCAGGGG + Intronic
968757407 4:2423906-2423928 CGGGAGCCTGCCCTGGGCCCCGG - Intronic
969489563 4:7491320-7491342 CCTGAGGCTGCACTGGGCTGGGG + Intronic
970200582 4:13600526-13600548 CCTGAGACTGCACTGGGCATGGG + Exonic
970240050 4:13999696-13999718 CCAGAGCCTACTCTCGGCTAAGG + Intergenic
973893597 4:55391432-55391454 TTGCAGGCTGCACTGGGCTAGGG + Intergenic
974554609 4:63428562-63428584 CCGGAGCCTGCCATGGGGTTTGG - Intergenic
975150077 4:71011422-71011444 GCGGAGGCTGCAGTGGGCTGAGG - Intronic
975578667 4:75887722-75887744 CTGGAGCCTCCACTAGGTTAAGG + Intronic
978076160 4:104532841-104532863 CAGGAGCCAGCACAGGGCAAAGG + Intergenic
978771318 4:112458966-112458988 CAGGATCCTGCACTGGTATAAGG + Intergenic
984405687 4:179326996-179327018 CTGGAGGCTGCAGTGAGCTAAGG - Intergenic
985484984 5:143423-143445 CAGGAGCCTGCTCTGGACCAGGG + Exonic
986184320 5:5422281-5422303 CCGGAGCCCGTCCTGGGCCAGGG - Intronic
986667131 5:10113831-10113853 CTAGTTCCTGCACTGGGCTATGG + Intergenic
989621088 5:43384962-43384984 GCGGAGCCTGCAGTGAGCCAAGG - Intronic
990888494 5:60621521-60621543 CCGGGGCCTGTCCTGGGGTAGGG + Intronic
995046376 5:107653317-107653339 CTGGAGCTTACACTGGGTTATGG - Intronic
996125399 5:119720448-119720470 CCGGAGCCTGTCATGGGCTGGGG + Intergenic
997411127 5:133691769-133691791 CCACAGCCTGCACAGGGATAAGG + Intergenic
997524187 5:134541899-134541921 CAGGACCCTGGACAGGGCTAAGG + Intronic
999571588 5:152925607-152925629 CCTGAGGCTGCACAGGGCTGTGG - Intergenic
1002092588 5:176813802-176813824 CAGGAGCCTGCCCTGAGCTTGGG + Intronic
1006672474 6:35737993-35738015 CCACAGCCTGAACTGGGCTGGGG + Intronic
1006903405 6:37517208-37517230 CCGGAGGATGGACTGGGCCATGG + Intergenic
1007059818 6:38927696-38927718 CAGGAGCATGCATTGAGCTAAGG - Intronic
1007161003 6:39792020-39792042 CCGGCTCCTCCTCTGGGCTACGG - Intergenic
1010185101 6:73134785-73134807 CCGCAGCCTGTCCTGTGCTAAGG + Intronic
1015790209 6:136957986-136958008 CCAGGGCCTGCACTGGGGCAGGG - Intergenic
1018059428 6:160078985-160079007 CCAGTGCCTGGACTGGGGTACGG + Intronic
1019054566 6:169213837-169213859 CAGGTACCTGCCCTGGGCTAAGG + Intergenic
1019352483 7:561505-561527 CCGGAGCCTGCACGCAGCTCAGG - Intronic
1021056099 7:16048125-16048147 GCGGAGCTTGCAGTGGGCTGAGG + Intergenic
1023973315 7:45008108-45008130 GCGGAGCCTGCAGTGAGCTGAGG - Intronic
1023983520 7:45082614-45082636 CCGGAGCCTGTACTGGGTCTGGG - Exonic
1026338374 7:69414192-69414214 GCGGAGCTTGCACTGAGCCAAGG - Intergenic
1026895881 7:74009896-74009918 CCGCTGCCTGCCCAGGGCTAAGG + Intergenic
1028759536 7:94480161-94480183 CAGGAGCATTCAATGGGCTAAGG - Intergenic
1029518516 7:101043994-101044016 CCGGGGCCTGCCATGGGGTAGGG - Intronic
1032094143 7:128929257-128929279 CAGGAGCCAGCACTGGGATTGGG - Intergenic
1036707850 8:11058674-11058696 CCGGAGCCTGTCGTGGGCTGGGG + Intronic
1038764723 8:30416548-30416570 ACGGAGCTTGCAGTGGGCCAAGG - Intronic
1041713976 8:60916922-60916944 GTGGAGCCTGCACTGGGGTGGGG + Intergenic
1042728756 8:71908012-71908034 GCGGAGCCTGCAGTGAGCCAAGG - Intronic
1043145380 8:76647782-76647804 CCGGAGGTTGCACAGGGCAATGG - Intergenic
1044884839 8:96766185-96766207 CCCTAGCAAGCACTGGGCTAAGG - Intronic
1045710395 8:104976312-104976334 CAGGAGCCTTCAGTGGGCTGAGG - Intronic
1045799305 8:106083323-106083345 ACAGAGCCTGCTCTGGGCTCAGG - Intergenic
1046862173 8:119105872-119105894 CCGAATCCTGCAGTGGGTTAGGG - Exonic
1049433407 8:142575538-142575560 CCGCAGCTTGCACTGGGCAGGGG + Intergenic
1050388317 9:5112344-5112366 CCGACTCCTGCAGTGGGCTAGGG + Intronic
1056143606 9:83707843-83707865 CCAGAGCCTGCACCGAGCTCCGG - Exonic
1056338898 9:85604032-85604054 CTGGAACCTGCCCTGGGCTGAGG + Intronic
1061907060 9:133704214-133704236 CTGGAGCCTGGCCTGGGCTGTGG + Intronic
1062443374 9:136583424-136583446 CTGGTGCCTGCACTGGGCCCGGG - Intergenic
1062523510 9:136969277-136969299 CTGGAGCCTGCCCCGGGCCAGGG + Exonic
1062688196 9:137827251-137827273 CCAGAGCCTGCCCTGGACTTAGG - Intronic
1203774966 EBV:67832-67854 CCGGGGCCTCCTCTGGGCTCTGG - Intergenic
1203425394 Un_GL000195v1:32427-32449 CCCCAGCATGCACTGGGCTCAGG - Intergenic
1186686504 X:11930220-11930242 TCACAGCCTGCATTGGGCTAGGG + Intergenic
1197526811 X:127574906-127574928 CCAGAGCATGCACTGGGAGAGGG - Intergenic