ID: 901789535

View in Genome Browser
Species Human (GRCh38)
Location 1:11647120-11647142
Sequence CTGCATCTCCACCACTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901789533_901789535 -10 Left 901789533 1:11647107-11647129 CCCAGAGCAGGGGCTGCATCTCC 0: 1
1: 0
2: 6
3: 62
4: 430
Right 901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 253
901789527_901789535 11 Left 901789527 1:11647086-11647108 CCTTGTCAGACTGAGGATGCCCC 0: 1
1: 0
2: 1
3: 8
4: 118
Right 901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 253
901789526_901789535 12 Left 901789526 1:11647085-11647107 CCCTTGTCAGACTGAGGATGCCC 0: 1
1: 0
2: 0
3: 6
4: 122
Right 901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 253
901789531_901789535 -8 Left 901789531 1:11647105-11647127 CCCCCAGAGCAGGGGCTGCATCT 0: 1
1: 0
2: 5
3: 64
4: 375
Right 901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 253
901789532_901789535 -9 Left 901789532 1:11647106-11647128 CCCCAGAGCAGGGGCTGCATCTC 0: 1
1: 1
2: 4
3: 55
4: 404
Right 901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG 0: 1
1: 0
2: 0
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901789535 Original CRISPR CTGCATCTCCACCACTGCAC TGG Intergenic
900437521 1:2638589-2638611 CTGCAGATCCACCACTTCCCTGG - Intronic
900554321 1:3272207-3272229 CTGCATCTGCAGCACTCCACGGG + Intronic
900595459 1:3478316-3478338 CTGCCTCCCCACCACTGCAGGGG + Intronic
901185924 1:7373166-7373188 CTGCATGTCCTACAATGCACAGG - Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG + Intergenic
902140613 1:14350601-14350623 CTGAATATCCAGCAATGCACTGG + Intergenic
905775450 1:40664994-40665016 CTGCTTCTCAACCAGGGCACAGG + Intronic
906059195 1:42937260-42937282 CTGCACCTCCACCACCGTGCTGG - Intronic
906556222 1:46716774-46716796 CTGCAATTCCATCTCTGCACTGG + Intronic
907946326 1:59139682-59139704 CAGCACCACCACCACTGCATAGG - Intergenic
908899581 1:68940909-68940931 CTTCATCCCCACCAATGCAAGGG - Intergenic
915366172 1:155317791-155317813 CTGTGACTGCACCACTGCACTGG + Intronic
917456604 1:175191489-175191511 CTGCCTCTCCAGCCCAGCACTGG + Intronic
922770726 1:228181566-228181588 CTGCATCTCCACACTTGCACAGG + Exonic
924611305 1:245575994-245576016 CTGCACCTCCACTCCTGCAAAGG + Intronic
1063124392 10:3126316-3126338 CTGCAAGACCACCACAGCACTGG - Intronic
1063375627 10:5552693-5552715 CTGCATCTCCACCACCCGCCAGG + Intergenic
1064066880 10:12189713-12189735 CAGCGTCTCCGCCACTGCAACGG + Intronic
1064265370 10:13821251-13821273 CTGCCTCTCCAGCACAGCCCTGG + Intronic
1066549869 10:36544609-36544631 CTGGAGCTCCACCAGTTCACAGG + Intergenic
1067567379 10:47348983-47349005 CTGGATCTCCGGCACTGCACAGG + Exonic
1067600557 10:47593398-47593420 TTGCATCTGCAACAGTGCACTGG - Intergenic
1068238000 10:54263397-54263419 CTGCATCCGCAACAGTGCACTGG - Intronic
1068289072 10:54978275-54978297 CTGAATCCCCACTACTTCACAGG - Intronic
1070464283 10:76703903-76703925 CTCCATGGCCACCACTGCCCAGG - Intergenic
1071652089 10:87401270-87401292 TTGCATCTGCAACAGTGCACTGG - Intergenic
1072421210 10:95291577-95291599 CAGCATCTGGACCACTGCCCGGG + Intergenic
1073456776 10:103641660-103641682 CTGCTTCTCCTCCACTCCACTGG + Intronic
1075173379 10:120136683-120136705 CTGCATTTCCAGCTCTGTACTGG + Intergenic
1075874339 10:125794010-125794032 CTGGATACCCACCACTGGACTGG + Intronic
1077074049 11:692030-692052 CTGCCTCTCCTCCACCGCAGGGG + Intronic
1077094126 11:792204-792226 CCGCGTCTTCACCACTGCAAGGG + Exonic
1083166293 11:60890167-60890189 CTTCATCACCACCACTTCAGAGG + Intergenic
1083614304 11:64018775-64018797 CTGCATCTCCCCCAGTCCCCGGG - Intronic
1083931624 11:65849482-65849504 CTGCAGATCCACCGATGCACAGG - Exonic
1084068589 11:66719510-66719532 GTTTATCTCCACCACTGAACTGG - Intronic
1084457387 11:69275934-69275956 CTTCCTCTGCTCCACTGCACAGG - Intergenic
1086649035 11:89264168-89264190 CTGCATTTCCACCTCTGGATTGG - Intronic
1088321987 11:108563741-108563763 CTGCCTCTCCACCCCTTCAGTGG - Intronic
1089871448 11:121676123-121676145 CTGCATCTCCAGCAAGGCATGGG - Intergenic
1090958881 11:131538204-131538226 CTGCAATTCCAGCAATGCACAGG + Intronic
1091901436 12:4147260-4147282 CTGCTTCTCTACCCCTGCAGGGG + Intergenic
1092132247 12:6120704-6120726 CTGCATCCCCACAACAGCCCTGG - Intronic
1092950485 12:13498947-13498969 TAGCATCTCCACCCCAGCACAGG - Intergenic
1095494553 12:42771001-42771023 CAGCATCTGCACCACAGCAGTGG + Intergenic
1095820545 12:46473825-46473847 CCGTATCTCCACCACTGGAGAGG - Intergenic
1096767254 12:53901886-53901908 CTACATGTCCATCACTGCCCTGG - Intergenic
1098426609 12:70371412-70371434 CTGCCTCTCCTACAGTGCACTGG - Intronic
1099768454 12:87021158-87021180 CTACATCAGAACCACTGCACAGG - Intergenic
1101282953 12:103278532-103278554 CCTCATCTCCACTCCTGCACTGG + Intronic
1101740203 12:107494667-107494689 GGGCATCTCCTCCACTGCTCTGG + Intronic
1102863288 12:116354795-116354817 CTGCATGTCCAGCACTGTGCTGG + Intergenic
1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG + Exonic
1104019213 12:124980544-124980566 CTGCAGCCCCACCACTGCCCAGG - Exonic
1104164050 12:126209170-126209192 CTGCATCCCCAGCACAGGACTGG + Intergenic
1105060526 12:133146240-133146262 TTACGTCACCACCACTGCACTGG + Intronic
1106755142 13:32814989-32815011 CACCATCTCCAACACTGCAGTGG + Intergenic
1106945594 13:34824257-34824279 CAGCATCTCCACCACTAGACTGG - Intergenic
1109506780 13:63312098-63312120 CCGCATGTCTACCACCGCACAGG - Intergenic
1110699059 13:78526011-78526033 CAGAATCTCCAGCCCTGCACTGG - Intergenic
1111266903 13:85827303-85827325 TGGCATCTCCACCAATGAACTGG + Intergenic
1113574846 13:111388104-111388126 CTGTTTCTCCACCTCTGCTCTGG + Intergenic
1113842472 13:113367996-113368018 CTGCATCTGAACCCCTGCCCAGG - Intergenic
1114344404 14:21780583-21780605 CCGCACCTCCCCCACTGCAGCGG - Intergenic
1114933646 14:27506759-27506781 CTGCATTTCTACCACAGCAGTGG + Intergenic
1114992083 14:28299472-28299494 CTGCTTCTCCAGCACCTCACAGG - Intergenic
1116222880 14:42111489-42111511 CTGCATCCACATCTCTGCACAGG + Intergenic
1117077206 14:52116597-52116619 CTGCATCTCCACCAGTGTATAGG + Intergenic
1120597347 14:86457392-86457414 CTGGATCTCCTACAATGCACAGG + Intergenic
1121023831 14:90599704-90599726 CTGCATGCCCACGACTGCAGTGG - Intronic
1122635313 14:103126996-103127018 CTTCAGCTCCTCCACTGCGCCGG - Exonic
1122934932 14:104951554-104951576 CTGCATGTCCACCTCCACACTGG + Exonic
1123694863 15:22871560-22871582 CTGCATTGCCTCCACTCCACGGG + Intronic
1124192594 15:27593498-27593520 TTGCATCTCCAGCACTGCAGTGG + Intergenic
1125582917 15:40799779-40799801 CTGCACCACCAACAATGCACAGG + Intronic
1126349631 15:47730870-47730892 CTGCTTCTTCACGACTGCAGGGG + Intronic
1127138615 15:55950823-55950845 ATGCATCTCTACCACTGCTCTGG + Intronic
1127726370 15:61753847-61753869 TTCCATCAGCACCACTGCACTGG + Intergenic
1128156526 15:65395112-65395134 CCGCACCTCCACCCCAGCACTGG - Exonic
1128311634 15:66634594-66634616 CTGCAACCTAACCACTGCACAGG - Intronic
1128762922 15:70230146-70230168 CTCCATCTGCCCCATTGCACAGG - Intergenic
1129697880 15:77750939-77750961 CTGCATCTTTCCCACTGGACTGG - Intronic
1130507349 15:84557676-84557698 CTGCCTCTCTCCCACTGCAGTGG - Intergenic
1130966906 15:88704889-88704911 ATGTATCTCCACCACTAGACTGG + Intergenic
1132550758 16:553056-553078 CTGCCCCCCCACCCCTGCACAGG + Intronic
1132829057 16:1918638-1918660 CGGCATCTTCACCTCTGCGCGGG + Intergenic
1133258199 16:4531571-4531593 CGTCATCTCCAGCACTTCACAGG - Intronic
1133814904 16:9189598-9189620 CTGCCTCCCCTCCCCTGCACAGG + Intergenic
1137056069 16:35747243-35747265 CTTCATTCCCACCACTGCCCAGG + Intergenic
1137587662 16:49673512-49673534 CTGCAGCTCCCACACTGCCCTGG + Intronic
1137594726 16:49716065-49716087 CTGCTCCTCCCCCACTGCCCTGG - Intronic
1137883966 16:52082185-52082207 CTCCATCGTCATCACTGCACTGG - Intergenic
1138414831 16:56865652-56865674 CTGCAGCTCCACTATTTCACTGG - Intronic
1141136951 16:81472738-81472760 CGGCCTCTCCACATCTGCACAGG - Intronic
1142899705 17:3004398-3004420 CTGCATCTGCTCCACTTCACAGG + Intronic
1143724628 17:8836736-8836758 CTGCACCTCCAACATTGCCCAGG - Intronic
1144632298 17:16880461-16880483 CTACATCCTCATCACTGCACGGG + Intergenic
1144707240 17:17377795-17377817 CTGCGTCTCCACCTCCGCCCAGG + Intergenic
1145977661 17:28993580-28993602 CCCCAACTTCACCACTGCACTGG - Intronic
1146124077 17:30218337-30218359 CTCCATCTCACCCACTGCCCAGG - Exonic
1147677591 17:42218773-42218795 CAGCATCTCCTCCACTGGGCCGG + Exonic
1147688448 17:42300798-42300820 CAGCATCTCCTCCACTGGGCCGG - Exonic
1148125354 17:45233789-45233811 CTGCATCTCACCCACTCCCCTGG + Intronic
1148318609 17:46728103-46728125 CTGCATATGCACCTCTGCCCTGG - Intronic
1148670618 17:49407365-49407387 CAGCAGCTCCACCACTGAACAGG + Intronic
1156279008 18:35614560-35614582 CTGCCTCTTCACAATTGCACTGG + Intronic
1156791378 18:40978779-40978801 CTGCATCTCCACCTTTGCCATGG - Intergenic
1157312990 18:46566261-46566283 CTGGATCTCCACCACCTCGCTGG + Intronic
1158650994 18:59285645-59285667 CTGCTTCTCCACCACCGTGCAGG + Intronic
1159133754 18:64311375-64311397 CTCCCTCTCCTCCACTGCAATGG + Intergenic
1159972759 18:74674230-74674252 CTCCAGCTCCAGCACAGCACTGG - Intronic
1160486364 18:79296827-79296849 GTGCATCTCCCCTACTGCAGTGG - Intronic
1161549616 19:4904634-4904656 CTGCATCTCCCCCATTGGATGGG + Intronic
1163255951 19:16155959-16155981 TTCCATCTCCACCAGTGCCCAGG - Intronic
1164526716 19:29018403-29018425 GTGCATATCCACCGGTGCACAGG - Intergenic
1164709222 19:30343517-30343539 CTTCATCTCCACCTGGGCACAGG - Intronic
1165008957 19:32829274-32829296 CTGCATTTTCACGAGTGCACAGG - Intronic
1165714356 19:38034915-38034937 CTGCATCCCCACTACTCTACAGG - Intronic
1166053582 19:40275331-40275353 CTGCATCGCCACCACCTCCCTGG + Intronic
1166713771 19:44953624-44953646 CTGTATCTCCAGCACTGCCCTGG - Intronic
1167534567 19:50041534-50041556 CTCCCTCTCCATCACTGGACTGG + Intronic
925099355 2:1232102-1232124 CTGCTTCTGCAGCACTGCCCGGG + Intronic
925246159 2:2385218-2385240 CTCCATCTCCACAACTGCGCAGG - Intergenic
925842972 2:8009594-8009616 CTGCTTCTGCACCCCTGCAATGG + Intergenic
926240444 2:11081047-11081069 CTGCATCGCCACGACGGAACAGG + Intergenic
926969404 2:18451918-18451940 CTGGCACTCCAGCACTGCACTGG + Intergenic
932769748 2:74493950-74493972 CTGTTTCTCCACCCCAGCACTGG + Exonic
934648541 2:96073338-96073360 CTGCACCCCCACCCCTGCCCAGG + Intergenic
935736535 2:106111036-106111058 CTGCAGCTCCAGCAGAGCACGGG - Intronic
936079825 2:109424381-109424403 CTGAAGCCCCACCACTGGACAGG - Intronic
938716652 2:134027798-134027820 CTGCAGCTGCACCCCTGCAGGGG + Intergenic
939340814 2:140894383-140894405 CAGCATCTGCACCACAGCACAGG - Intronic
940786683 2:157989023-157989045 CTGGATCCCCACCTGTGCACTGG - Intronic
941043464 2:160648457-160648479 CTGCACCTCACCCACTGCCCTGG + Intergenic
941234532 2:162953617-162953639 GAGCAACTCCACCTCTGCACTGG + Intergenic
941644245 2:168023436-168023458 CTGCACCTCCACCACTGGGAAGG - Intronic
942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG + Intergenic
947840514 2:233204601-233204623 CTGCACCTCCAGCACTCCAAGGG + Exonic
947933521 2:233983979-233984001 GTGCCTTTCCACCACTGCAGGGG - Intronic
948542169 2:238698889-238698911 CTTCATCTCCATGACTGCCCTGG + Intergenic
948552643 2:238784683-238784705 CTGTATCTACAACACTGCGCTGG - Intergenic
1169213428 20:3779880-3779902 CCGCATCTCCACCCCTCCATTGG - Intronic
1169392574 20:5202495-5202517 CTGCAGTTCCTCCACAGCACAGG - Intergenic
1169899961 20:10542929-10542951 CTGCATTTCCAGCACTGGAATGG - Intronic
1170861030 20:20103854-20103876 CTGCATTTCCACAGCTGTACTGG + Intronic
1171960167 20:31487768-31487790 CTGCCTCTCCACCATTGATCTGG - Intergenic
1172996851 20:39077163-39077185 CTGCCTGTCCACCACTCCAGGGG + Intergenic
1173861222 20:46284963-46284985 CTGCCTCTCCATCTCTGCTCAGG + Intronic
1174488266 20:50874694-50874716 CTTGATCTCCCCCTCTGCACTGG + Intronic
1175339014 20:58215800-58215822 CTGTATCCCCACCTCCGCACAGG + Intergenic
1176181409 20:63751550-63751572 ATGGGTATCCACCACTGCACTGG + Intronic
1177789841 21:25710951-25710973 CAGCATCTCCAACACTGCTTTGG - Intronic
1178097038 21:29226989-29227011 CTCTATCTCAACCACTGCAGAGG - Intronic
1178282366 21:31294409-31294431 CTGCTTCTCCACCACAGAGCAGG + Intronic
1180091970 21:45537927-45537949 CTGCTTCTCCACCGCTGGGCTGG + Exonic
1180141097 21:45893700-45893722 CTAAATCTCCAGCACTGGACGGG + Intronic
1181013703 22:20056536-20056558 CTGGCTCTGCACCACTGCCCAGG + Intronic
1181341366 22:22182429-22182451 CTCCTCCTCCACCACTGCAGAGG + Intergenic
1182795052 22:32985796-32985818 CTGCCTCTGAACCTCTGCACAGG + Intronic
1183225517 22:36547288-36547310 CTCCATCTCCTCCACTGCTCTGG - Intergenic
1183352218 22:37340662-37340684 CTGGCTCTCCATCACTGCCCAGG - Intergenic
1185126487 22:49013948-49013970 CAGCATCGGCTCCACTGCACAGG + Intergenic
1185226883 22:49658279-49658301 CTGCACCTCCTCCACCTCACTGG + Intergenic
950705526 3:14777590-14777612 CTGCATCTGCACCAGTGGCCTGG - Intergenic
951519640 3:23599283-23599305 CTGCATCTACACCAGCCCACAGG - Intergenic
954771028 3:52969009-52969031 CTGTTTCTCTACCACTGAACTGG - Intronic
954962082 3:54575645-54575667 CTCCCTCTCCAAGACTGCACTGG - Intronic
954967951 3:54627420-54627442 CTGCATATGCACCCCTCCACTGG - Intronic
961524182 3:127486105-127486127 CTGCAGCTCCGCCACTGCTGTGG - Intergenic
962094878 3:132283447-132283469 TTCCATCTCCACCACTCCACAGG + Intronic
962176753 3:133163305-133163327 CTGCCTCTTCCCCACTGGACAGG - Intronic
963528817 3:146447734-146447756 CTCCATGTCCAGCACAGCACCGG + Intronic
966895948 3:184445221-184445243 CTGCATCTTCAGCACTGCTGAGG + Intronic
967664939 3:192159804-192159826 CTACATATCCTCCAATGCACAGG + Intronic
968632796 4:1660938-1660960 CTGTATCTGCACAGCTGCACAGG + Intronic
968653755 4:1770023-1770045 CTGCACGTTCACCTCTGCACTGG - Intergenic
968678501 4:1899345-1899367 CTGCATCTCCTGCAACGCACAGG - Exonic
968717721 4:2174142-2174164 CTGCATGCCAACCTCTGCACAGG + Intronic
969689720 4:8697875-8697897 CTGGGTCCCCACCACTGCCCTGG + Intergenic
970156842 4:13150418-13150440 CTGCTTGTGCACCACTGGACTGG - Intergenic
972262659 4:37425984-37426006 TTCCATCTCCACCCCTGCTCTGG + Intronic
979279018 4:118843597-118843619 CTGCATCTCCTCCACTCCTCAGG - Intergenic
979780670 4:124647837-124647859 CCACTTCACCACCACTGCACAGG - Intergenic
982545030 4:156723880-156723902 CTGCACCTCCCCCACTGTAGTGG - Intergenic
983907372 4:173198003-173198025 CTGCATTTCAACCCCTGCAAGGG + Intronic
985833047 5:2250033-2250055 CTGCATCTCCTCGACGCCACCGG + Intergenic
986237310 5:5923948-5923970 CAGCATCCCCACCAATGTACTGG + Intergenic
990514372 5:56518136-56518158 CTCCATCGCCCCCTCTGCACTGG + Intronic
991020687 5:61977080-61977102 CTACATCTCCAAGACTGCCCAGG - Intergenic
995255930 5:110046577-110046599 CTGCATCACCCTCACTGGACGGG + Intergenic
995896223 5:117013970-117013992 ATGCATTCCCACCACAGCACTGG + Intergenic
996004067 5:118400068-118400090 CTGCATCATCACCAGTGCCCTGG - Intergenic
996892367 5:128436874-128436896 CTACATCTCCACCTCAGCCCAGG - Intronic
997925490 5:138027082-138027104 CTGTGACTGCACCACTGCACTGG + Intronic
1001223814 5:169926800-169926822 CTGCATCTCAGGCACTGCAGTGG + Intronic
1002309096 5:178303803-178303825 CTGCTTCTCCACCAAAGCATGGG - Intronic
1003066818 6:2910875-2910897 CTGAATGTCCTGCACTGCACAGG - Intergenic
1003570555 6:7253772-7253794 CTGCATCTCTAACACAGCGCAGG - Intergenic
1007172271 6:39872151-39872173 CACCAGCTCCACCACAGCACAGG - Intronic
1007221865 6:40285176-40285198 CTCTGTCTCCACCACAGCACAGG + Intergenic
1007660202 6:43479640-43479662 CTGCATCTCCTACGCTGCCCAGG - Intronic
1007935775 6:45730500-45730522 CTGTATCTCCACCCCTTCCCTGG - Intergenic
1009235736 6:61121577-61121599 CTGCATCCCCACCAGTCCATGGG - Intergenic
1015884692 6:137904634-137904656 CTGCATCTCCTCAACCACACAGG + Intergenic
1018915781 6:168131568-168131590 CTGCTTCTCCACCTGTGCTCCGG + Intergenic
1019188644 6:170236770-170236792 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188650 6:170236824-170236846 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188675 6:170237094-170237116 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188682 6:170237148-170237170 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188689 6:170237202-170237224 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188694 6:170237256-170237278 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188699 6:170237310-170237332 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188704 6:170237364-170237386 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188711 6:170237418-170237440 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188717 6:170237472-170237494 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188727 6:170237580-170237602 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188740 6:170237688-170237710 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188745 6:170237742-170237764 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188750 6:170237796-170237818 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188755 6:170237850-170237872 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188762 6:170237904-170237926 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188773 6:170238012-170238034 CTGCGTCTCCCTCACTGCAAAGG + Intergenic
1019188780 6:170238071-170238093 CTGCATCTCCCTCACTGCGAAGG + Intergenic
1019497660 7:1347949-1347971 CTCCTTCTCTACCCCTGCACGGG - Intergenic
1019557531 7:1640141-1640163 CTGTGACGCCACCACTGCACTGG - Intergenic
1022931916 7:35126439-35126461 ATGCATCTACACCACTGCTTTGG - Intergenic
1023991412 7:45131033-45131055 CAGCATCTCCGCCTCTACACTGG - Intergenic
1024350675 7:48359599-48359621 CTCCATCACCACTACTGCCCAGG - Intronic
1024541374 7:50477549-50477571 CTGCACTTCATCCACTGCACAGG + Intronic
1024980380 7:55153167-55153189 CGGCTCCTCCACCACTGCTCAGG + Intronic
1027266016 7:76495673-76495695 CTGCATCTCCAGCACCCCGCTGG - Intronic
1027317390 7:76993790-76993812 CTGCATCTCCAGCACCCCGCTGG - Intergenic
1028640659 7:93039325-93039347 CTGCACCTCCCCCACTGCAGCGG - Intergenic
1029103407 7:98153303-98153325 CTGCTTCTCCCTGACTGCACTGG - Intronic
1029827803 7:103218917-103218939 ATGCATCTACACCACTGCTTTGG - Intergenic
1031128219 7:117799656-117799678 CTTCTTCCCCACCACTGCCCTGG - Intronic
1032793482 7:135259381-135259403 TTGCACCTCCACAACTGCATGGG + Intergenic
1034281964 7:149860895-149860917 CTGCAGCTCCTCCAAAGCACGGG + Exonic
1034834920 7:154343354-154343376 CTGCATCTTCGCAAGTGCACAGG + Intronic
1036584729 8:10113040-10113062 CTGCAGCTCCATCACCTCACAGG + Intronic
1036629125 8:10498077-10498099 CTGTAGCTCACCCACTGCACTGG - Intergenic
1037704776 8:21309843-21309865 CTGCATCTCACCCTCTGCAATGG + Intergenic
1038969005 8:32609722-32609744 CAGGATCTCGGCCACTGCACTGG + Intronic
1039618368 8:38974699-38974721 CCGCAGTTCCCCCACTGCACAGG - Exonic
1040020537 8:42737033-42737055 CTGGATCTCCCACCCTGCACTGG + Exonic
1040065635 8:43141471-43141493 CTCCATCTAGACCCCTGCACCGG + Intronic
1040480246 8:47819044-47819066 CTGCCTCTTCCCCACTGCTCAGG + Intronic
1040668536 8:49658926-49658948 CTGCACCCCCACCACAGCAGTGG - Intergenic
1041178396 8:55221679-55221701 CTCCCTCCCCATCACTGCACTGG - Intronic
1041497808 8:58506469-58506491 CTGCATCTCCAGCACTTAAAAGG - Intergenic
1044513779 8:93114840-93114862 CTTTATCTCCACCAGTGCAATGG - Intergenic
1048199475 8:132359924-132359946 CTGCATCTCCATGCCTGCACTGG + Intronic
1048570747 8:135653448-135653470 CTACATTTCCACCACTGTAAAGG - Intronic
1048862347 8:138733142-138733164 CTGCATTTCCACCAATTCAAGGG + Intronic
1049011624 8:139891362-139891384 CTGCCCCTTCACCACTGGACAGG - Intronic
1049468701 8:142765421-142765443 CTGCTGCACCACCACTGCCCTGG - Intronic
1053164666 9:35835954-35835976 CTGCTTCTCCTCCAGTGAACAGG - Intronic
1053785617 9:41650591-41650613 CTACATCCCCACCAGGGCACAGG + Intergenic
1054174336 9:61864557-61864579 CTACATCCCCACCAGGGCACAGG + Intergenic
1054663202 9:67716234-67716256 CTACATCCCCACCAGGGCACAGG - Intergenic
1057928253 9:99171354-99171376 CTGCATCCTCCCCACAGCACAGG + Intergenic
1059822192 9:117985670-117985692 CTACATTTCCTCTACTGCACTGG + Intergenic
1060197363 9:121632376-121632398 CTGCATCTCCTCCAGTCCACTGG - Intronic
1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG + Intergenic
1060933094 9:127501088-127501110 CTGCACCTCCAGCTCTGCAGGGG - Exonic
1061397196 9:130349588-130349610 CTGCAGCTCCACGTCTGCACCGG - Intronic
1062382058 9:136291244-136291266 CTGGAGCTCCTCCACTGCACGGG - Exonic
1062399512 9:136366275-136366297 CTGCCTTACCCCCACTGCACCGG + Intronic
1189665428 X:43350118-43350140 CTGCATCTGCAACAGTGGACGGG + Intergenic
1192033720 X:67543067-67543089 TTGCATCTCCACCTTTACACAGG + Intergenic
1194664001 X:96656799-96656821 CTGCATCTCCTCTACAGCAAGGG + Intergenic
1194898042 X:99469459-99469481 CTGCATCACTATCTCTGCACAGG - Intergenic
1195343622 X:103927299-103927321 CTGAATATCCTCCAATGCACAGG + Intronic
1195734816 X:108001214-108001236 CTGCACCACAACCTCTGCACAGG - Intergenic
1198675042 X:139122422-139122444 TTTCATCTCTACCACTCCACTGG + Intronic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic
1201367865 Y:13228253-13228275 CTGCCTCTCAACCTCTCCACTGG + Intergenic