ID: 901792038

View in Genome Browser
Species Human (GRCh38)
Location 1:11658762-11658784
Sequence CTGAACGCACAGCTGGTACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901792038_901792041 5 Left 901792038 1:11658762-11658784 CCAAGTACCAGCTGTGCGTTCAG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 901792041 1:11658790-11658812 GTCGTCCGCGCACGCGCCTCTGG 0: 1
1: 0
2: 0
3: 0
4: 27
901792038_901792043 7 Left 901792038 1:11658762-11658784 CCAAGTACCAGCTGTGCGTTCAG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 901792043 1:11658792-11658814 CGTCCGCGCACGCGCCTCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 46
901792038_901792042 6 Left 901792038 1:11658762-11658784 CCAAGTACCAGCTGTGCGTTCAG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 901792042 1:11658791-11658813 TCGTCCGCGCACGCGCCTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 17
901792038_901792046 26 Left 901792038 1:11658762-11658784 CCAAGTACCAGCTGTGCGTTCAG 0: 1
1: 0
2: 1
3: 9
4: 118
Right 901792046 1:11658811-11658833 GGGGACCTTCCAGCCAGACCCGG 0: 1
1: 0
2: 2
3: 14
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901792038 Original CRISPR CTGAACGCACAGCTGGTACT TGG (reversed) Exonic
900740230 1:4326696-4326718 CTGAACACACACCTGACACTGGG - Intergenic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
901796210 1:11681031-11681053 CCGAGCGCAGAGCCGGTACTGGG - Exonic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
905675360 1:39820910-39820932 CTGAGCACATGGCTGGTACTTGG - Intergenic
906349497 1:45045662-45045684 CTCAACCCACAGTGGGTACTGGG + Intronic
906907093 1:49907431-49907453 ATGAACTGACAGCTGGTACTAGG + Intronic
907930684 1:58996896-58996918 CTGAAAGCACAACTGATACAGGG + Intergenic
909109781 1:71460254-71460276 CTGACTGCAGAGCTTGTACTTGG - Intronic
910759565 1:90720397-90720419 CTGATCGCACAGCTTGTGTTGGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
912332267 1:108830577-108830599 CAGAAGGCACAGCTCGGACTGGG + Exonic
913159065 1:116129017-116129039 TTGAGCCCACAGCAGGTACTGGG - Intronic
919647217 1:200107075-200107097 CTGCACCCACAGCTGGCCCTTGG - Intronic
920033747 1:203052310-203052332 ATGAACTCACAGCTGCTTCTCGG - Intronic
922344320 1:224683703-224683725 CTGAATGCCCAGCTGGTAAAAGG - Intronic
922365947 1:224863878-224863900 CTAAAGGCACAGCTAGTATTTGG - Intergenic
1063965246 10:11341355-11341377 ATGAAAGCACAGCTTGCACTGGG - Intergenic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065600084 10:27359216-27359238 CTGAACACACAGGAGGCACTGGG + Intergenic
1066581927 10:36890678-36890700 CTGAACACACAGGAGGAACTCGG - Intergenic
1071789800 10:88941777-88941799 CTGGACGCACAACTGGTAGGTGG - Exonic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1076031017 10:127158539-127158561 CTGAACGCCCAGAAGGTACCAGG - Intronic
1076494972 10:130891090-130891112 CTGAAGTCACAGGTGGTCCTCGG + Intergenic
1077031433 11:469688-469710 CTGCAAGCATAGCTGGTTCTAGG - Intronic
1079148251 11:17873974-17873996 CTGAAAGCAGAGCTGGATCTGGG + Intronic
1080935138 11:36855356-36855378 CTGAACACAGAGCTAGTACATGG - Intergenic
1081577765 11:44329923-44329945 CTGGAGTCACAGCTGGCACTTGG - Intergenic
1085821802 11:79801787-79801809 CAGACCACACAGCTGGTAATAGG - Intergenic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1093077879 12:14775470-14775492 ATGAAAGCACAGCAGCTACTAGG - Intronic
1094205781 12:27838850-27838872 CTGAACACTCAGCTTGTCCTTGG - Intergenic
1096080254 12:48828118-48828140 CAGAACACACAGCTAGTACCTGG - Exonic
1102108255 12:110344332-110344354 CTGAACTCAAAGCTAATACTGGG + Intronic
1104015422 12:124958590-124958612 CTGAACGCCCAGCACATACTTGG + Intronic
1104031431 12:125067861-125067883 CTGATCACACAGCTGGTAAGTGG - Intronic
1107820487 13:44281335-44281357 CTGCATGCAGAGCTGGTCCTGGG + Intergenic
1108464367 13:50700065-50700087 CTGATACCACAGCTGGTAATGGG + Intronic
1109106581 13:58259565-58259587 CAGAACACTCAGCAGGTACTAGG + Intergenic
1110551505 13:76815708-76815730 CAGATCTCACAGCTGGTAATGGG + Intergenic
1113179598 13:107610136-107610158 ATAAACTCACAGCTGTTACTAGG + Intronic
1113849581 13:113410556-113410578 CAGGACGCACAGCTGCTCCTTGG - Intergenic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1120858742 14:89235471-89235493 CTGAACGCCCAGCAGGTCTTTGG + Intronic
1122122390 14:99561452-99561474 CAGAGCGCTCTGCTGGTACTTGG + Intronic
1127906417 15:63379626-63379648 CTGCAGACCCAGCTGGTACTGGG + Intronic
1128385494 15:67145271-67145293 CTCATAGCACAGCTGGGACTTGG + Intronic
1131095608 15:89652703-89652725 CTGAACGCAGGCCTGGTACACGG + Exonic
1132312223 15:100865584-100865606 CTGATCTCATAGCTGGTACATGG - Intergenic
1132843762 16:1990660-1990682 CTCAACTCACAGCTGGAACTGGG - Intronic
1134102440 16:11461640-11461662 CAGAACGCACAGGTGAAACTGGG + Intronic
1135049810 16:19183738-19183760 CAGCATGCCCAGCTGGTACTTGG - Exonic
1139010756 16:62630804-62630826 CAGAACACACAGCAGGTAGTTGG + Intergenic
1139379298 16:66520431-66520453 CTGAACGCATTGCTGGAACTAGG - Intronic
1142262522 16:89049619-89049641 GTGCCCGCACAGCTGGCACTGGG + Intergenic
1143326941 17:6105192-6105214 CTGGACGCACGGCTAGTGCTGGG - Intronic
1145128417 17:20320635-20320657 CTGCCCGCCCAGCTGCTACTCGG - Intergenic
1146055198 17:29577510-29577532 CTCAGGGCACAGCTGGCACTGGG - Intronic
1148700062 17:49581781-49581803 CTGAACTCTCAGCAGGCACTGGG + Intronic
1149664752 17:58357854-58357876 TTGAACAGACTGCTGGTACTGGG + Exonic
1152426242 17:80220225-80220247 CGGAACGCACTGCTGCTCCTCGG - Exonic
1156399951 18:36731322-36731344 GTGACCGCACAGCTGGTAGCTGG + Intronic
1156485149 18:37460845-37460867 ATCAACCCACAGCTGTTACTTGG - Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1158153218 18:54395226-54395248 CTGAAGGTACTGGTGGTACTGGG - Intergenic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1160803776 19:982621-982643 CTGGAGGCACAGCAGGTCCTTGG + Intergenic
1165489299 19:36114154-36114176 GTGAGCGTTCAGCTGGTACTGGG - Intronic
1166252151 19:41578567-41578589 CTGAACCAACATCTGGTCCTGGG - Intronic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
1168598238 19:57696270-57696292 CTGACCCCACAGCTTCTACTTGG - Intronic
926956976 2:18312367-18312389 CTGAACCCACACCTGCTACAGGG - Intronic
930004394 2:46884633-46884655 CTCTACACACTGCTGGTACTGGG - Intergenic
935580793 2:104754559-104754581 CTGGTCGCACAGCTGGTCATGGG - Intergenic
938605911 2:132892429-132892451 CTGAAAGCACATCTGGTGGTGGG - Intronic
942110947 2:172682294-172682316 ATGAAGGCTCAGATGGTACTGGG + Intergenic
944951369 2:204753572-204753594 CTGATTACACAGCTGGAACTAGG - Intronic
1168992242 20:2104323-2104345 CTGAGACCACAGCTGGGACTCGG - Intronic
1172047951 20:32094118-32094140 AAGAATGCACAGCTAGTACTGGG - Intronic
1173220070 20:41125281-41125303 CTGGAGGCAGGGCTGGTACTAGG + Intergenic
1174419604 20:50391037-50391059 CTGAAGGCAGAGCTGGAACTGGG + Intergenic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181937435 22:26448978-26449000 CTGAACCCACCGCTGCTCCTGGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184725279 22:46340927-46340949 CTCCACGGGCAGCTGGTACTGGG - Intronic
1185031995 22:48449027-48449049 CTGACCTCACAGCTGGGACGTGG - Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
952506954 3:34016090-34016112 CTGAACTCACAGCTGGTGAGTGG - Intergenic
954147943 3:48643507-48643529 CTGAAGGCCCACCTGGTTCTGGG + Intronic
955888843 3:63629180-63629202 AAGACCGCACAGCTGATACTTGG - Intergenic
960618875 3:119620504-119620526 CTGATCACACAGCTGGTAAGTGG - Intronic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
964119446 3:153167235-153167257 CTGAACACAGAGCTAGTTCTAGG + Intergenic
967916519 3:194582550-194582572 CTAAACCCACAGCTGGAACAAGG - Intergenic
971529665 4:27670644-27670666 CTGAAGGCCCAGCTGATACTTGG + Intergenic
975405409 4:73982815-73982837 CTGAAGACACAGCAGGCACTGGG - Intergenic
982320010 4:154067757-154067779 CTGAAGTCACAGCAGATACTGGG + Intergenic
992045573 5:72885248-72885270 CTGATAGCACATCTAGTACTGGG + Intronic
1003706674 6:8539352-8539374 CTGAACGCAGAGCTGGGACTTGG + Intergenic
1017647044 6:156548773-156548795 CTGAGCTCACTGCTGGTACTGGG + Intergenic
1018862474 6:167721006-167721028 CTGAACTCACAGCGGGTGCTGGG - Intergenic
1020631108 7:10640699-10640721 CTGAAGGAACAGCTGCTAGTTGG + Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1023153509 7:37224667-37224689 CTGAACTCCAAGCTGGTTCTTGG - Intronic
1024929031 7:54650457-54650479 CCTAAAGCACAGCTGGTCCTGGG - Intergenic
1025251342 7:57353444-57353466 CTGAAGGCAGTGCTGGAACTGGG - Intergenic
1027598321 7:80205061-80205083 CTGAACACTCAACTGGCACTTGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1036192749 8:6685809-6685831 CTGGAAGCTCAGCTGGGACTGGG - Intergenic
1039041264 8:33410854-33410876 CTGAAAGCAGAACTGGTACACGG + Intronic
1040035925 8:42869774-42869796 CTGAACCCATAGCTGCTACATGG + Intronic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1043962648 8:86434742-86434764 CTGAATGCATAGCTGGTACCTGG - Intronic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1047788740 8:128180667-128180689 CTGAGCACATAGCTGGTCCTCGG - Intergenic
1048583052 8:135746435-135746457 CTGAGCCCCCAGCTGGTCCTAGG + Intergenic
1048986744 8:139738814-139738836 CTGGGCGCAGAGCTGGTCCTGGG + Intronic
1049050683 8:140192550-140192572 CTGACTGCACAGCTGGTGCGAGG - Intronic
1051204961 9:14677501-14677523 CTGAACACAATGCTGTTACTCGG + Intronic
1052055852 9:23906681-23906703 ATGAAGCCACAGCTGGTCCTGGG - Intergenic
1062130396 9:134889647-134889669 CTGTAGGACCAGCTGGTACTGGG + Intergenic
1062536546 9:137023617-137023639 CTAAAGGCACAGCTGGTGCCTGG - Intronic
1186581800 X:10827513-10827535 CTCAAGGCTCAGGTGGTACTGGG + Intronic
1190832403 X:54070999-54071021 CTTAACCCACAGCAGGTCCTTGG - Exonic
1191953807 X:66622925-66622947 CTGATGGCAGAGCTGGGACTAGG - Intronic
1195543837 X:106092840-106092862 CTGAACCCAAAACTGGTATTTGG + Intergenic
1200232219 X:154449751-154449773 CTGCACCCACTGCGGGTACTGGG - Intronic