ID: 901793035

View in Genome Browser
Species Human (GRCh38)
Location 1:11664423-11664445
Sequence GGTCGCGTCCCCGGGGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901793021_901793035 18 Left 901793021 1:11664382-11664404 CCGTAGGCTCGGGCCGACCTGGA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 59
901793025_901793035 -8 Left 901793025 1:11664408-11664430 CCGCCGCTGCGCCCAGGTCGCGT 0: 1
1: 1
2: 0
3: 6
4: 76
Right 901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 59
901793023_901793035 1 Left 901793023 1:11664399-11664421 CCTGGAGCTCCGCCGCTGCGCCC 0: 1
1: 1
2: 1
3: 19
4: 254
Right 901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 59
901793022_901793035 5 Left 901793022 1:11664395-11664417 CCGACCTGGAGCTCCGCCGCTGC 0: 1
1: 0
2: 0
3: 16
4: 144
Right 901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 59
901793019_901793035 24 Left 901793019 1:11664376-11664398 CCGAGGCCGTAGGCTCGGGCCGA 0: 1
1: 0
2: 0
3: 2
4: 41
Right 901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901793035 Original CRISPR GGTCGCGTCCCCGGGGGGAC GGG Intronic
900677839 1:3899905-3899927 GGTCACGTCCCCGGGAGAAGGGG - Intronic
901793035 1:11664423-11664445 GGTCGCGTCCCCGGGGGGACGGG + Intronic
902856439 1:19209922-19209944 GGTCCCGGGCCCGGGGAGACTGG - Intronic
908796202 1:67833291-67833313 AGTCGGGTCCCCGCGGGGTCGGG - Intronic
912189224 1:107318215-107318237 GGTCATGTCCCAGGCGGGACAGG - Intronic
916660744 1:166920763-166920785 GGTCGCGGCCGCGGTAGGACGGG + Exonic
924199052 1:241640500-241640522 GGACGCGCCCGCGGGGGGGCGGG - Intronic
1063421013 10:5912515-5912537 GGTCCCTTCCCCAGGGAGACTGG + Intronic
1076977904 11:189480-189502 TGGCGCGTCCCCTGGGGGGCGGG + Intronic
1077327759 11:1971079-1971101 GGCCGGGGCCCCGGGAGGACAGG - Intronic
1083571563 11:63764383-63764405 GGGCGCGGCCCCGCGGCGACCGG + Exonic
1084588754 11:70078460-70078482 GGCCACGTCCCCGGCGGGCCTGG + Exonic
1085457048 11:76671036-76671058 GTTCGCGGCCCCGCGGGGTCCGG + Intergenic
1090709992 11:129375577-129375599 GAGCGCGTCCCGGGGGGGAGGGG + Intergenic
1094108002 12:26833394-26833416 CGTCGCGTCCCCGCGCGGGCCGG - Intergenic
1094841072 12:34342937-34342959 GTTCGCGCCCCTGGAGGGACTGG + Intergenic
1102240222 12:111320477-111320499 GGCCTCGTCCCCGCGGGGCCAGG - Exonic
1103521177 12:121537687-121537709 GGAGGCGTCCCCGTGGGGAAAGG + Intronic
1118598463 14:67454081-67454103 GGTTGTGTCCCCTGGGGGGCAGG + Intronic
1121444352 14:93969267-93969289 GGCGGCGTCTCCTGGGGGACAGG + Intronic
1122688942 14:103522593-103522615 GGCCGCGTCCCGGGGGGCGCCGG - Intronic
1141957781 16:87383899-87383921 GGTCGCCGCCCCGCGGGGAGGGG - Intronic
1142465326 17:133945-133967 TGGCGCGTCCCCTGGGGGGCGGG + Intergenic
1143152424 17:4815832-4815854 GGTAGCATTCCTGGGGGGACTGG + Exonic
1147822929 17:43252519-43252541 GGCCCCGTACCCGAGGGGACGGG + Intergenic
1152681362 17:81670046-81670068 GGTCACGTCCCCGGGGATGCCGG + Intronic
1161072400 19:2269446-2269468 GGTCGCGTTCCCGGCGGCGCGGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1164890769 19:31821321-31821343 GGTCACATCCCTGGGGGGCCGGG + Intergenic
1166888195 19:45973800-45973822 GGACGCGCCACTGGGGGGACGGG + Intergenic
933893267 2:86789823-86789845 GGAGGCGTCCCCGTGGGGAAAGG - Intronic
936079319 2:109421591-109421613 GTTCGCCTGCCCTGGGGGACAGG + Intronic
937223076 2:120353220-120353242 GGTCTGGCCCCCGGGGGCACTGG + Intergenic
945117282 2:206420277-206420299 GGCGGCGTCCACGGGGGGAAAGG + Intergenic
947662879 2:231882866-231882888 GGCCGCCTCCCCAGGGGGAAAGG + Intergenic
948881158 2:240857852-240857874 GGTCCCGCCCCAGGGAGGACAGG + Intergenic
1175919173 20:62441991-62442013 GGGGGCGTACCCTGGGGGACTGG + Intergenic
1180197855 21:46208201-46208223 GGCGGCCTCCCCTGGGGGACGGG + Intronic
1180791476 22:18577688-18577710 GGGCGCGTCCCCGGGGAGAGGGG - Intergenic
1181230263 22:21417623-21417645 GGGCGCGTCCCCGGGGAGAGGGG + Intronic
1181248387 22:21517240-21517262 GGGCGCGTCCCCGGGGAGAGGGG - Intergenic
1181674427 22:24442483-24442505 GGTCCTGTCCTCGAGGGGACAGG + Intergenic
1182586688 22:31347376-31347398 GGTAGCATCCCCGGGCGGGCCGG - Intergenic
1183856121 22:40636371-40636393 GCGCGCGTCCTCGGGGGGTCGGG - Intronic
950433932 3:12967551-12967573 GGTCGGGTCTCCGGGTGGCCGGG - Exonic
954796089 3:53161896-53161918 GGGCGCGGCTCCGGGAGGACGGG - Intronic
961665888 3:128492915-128492937 GGCGGCGCCCCCGGGCGGACGGG + Exonic
966919906 3:184604506-184604528 GGGCGCGTCCCGGCGGGGCCGGG + Intronic
968879854 4:3293224-3293246 GGCGGCGACCCCGAGGGGACGGG - Intronic
985783532 5:1882651-1882673 GGGCGCGGCCCGGGGCGGACGGG + Exonic
1001906700 5:175478898-175478920 GGCCTCGTCCCCGGTGGGAAGGG + Intronic
1004044477 6:12011849-12011871 GGGGGCGTCCCCGCGGGGGCTGG - Intronic
1006320187 6:33315484-33315506 GGTGGGGTCCCTGGAGGGACTGG - Exonic
1017161056 6:151366406-151366428 GGTCTCCTCCCCGGGAGGAGGGG + Exonic
1024579898 7:50793159-50793181 GTTGGCGTCCCCGCGGGGCCCGG - Intronic
1035024865 7:155818751-155818773 GGTCGGCTTCCCGGGGGGACAGG + Intergenic
1039952015 8:42180102-42180124 GGCCGCGTCCCCGGGAGGGGAGG + Intronic
1049570539 8:143368434-143368456 GGTCCCGTTGCCGGGGTGACAGG + Intergenic
1057757872 9:97852259-97852281 GGGCGCGTCTCCGGGGGAAGGGG - Intergenic
1186611697 X:11144076-11144098 GGACGCGGCCCCGGGGGGCTCGG - Exonic
1187648291 X:21374025-21374047 GGTGGCGGCCACGGCGGGACGGG - Intergenic
1190844871 X:54182673-54182695 GGTCATGTTCCCGGGGGGCCTGG - Exonic
1191797321 X:65034937-65034959 GGTCGCATCGCTGAGGGGACTGG + Intergenic
1199880962 X:151974208-151974230 GGGAGCGGCCCCGGGGTGACCGG - Intronic