ID: 901794674

View in Genome Browser
Species Human (GRCh38)
Location 1:11673439-11673461
Sequence TACCCACTCCTCCCAGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 1, 2: 1, 3: 62, 4: 446}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901794669_901794674 -3 Left 901794669 1:11673419-11673441 CCTCACCCACTTGCTCTCTCTAC 0: 1
1: 0
2: 4
3: 54
4: 516
Right 901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG 0: 1
1: 1
2: 1
3: 62
4: 446
901794670_901794674 -8 Left 901794670 1:11673424-11673446 CCCACTTGCTCTCTCTACCCACT 0: 1
1: 0
2: 4
3: 23
4: 441
Right 901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG 0: 1
1: 1
2: 1
3: 62
4: 446
901794668_901794674 17 Left 901794668 1:11673399-11673421 CCACATGGACAGAGGTGAGGCCT 0: 1
1: 0
2: 1
3: 25
4: 339
Right 901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG 0: 1
1: 1
2: 1
3: 62
4: 446
901794671_901794674 -9 Left 901794671 1:11673425-11673447 CCACTTGCTCTCTCTACCCACTC 0: 1
1: 0
2: 5
3: 73
4: 710
Right 901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG 0: 1
1: 1
2: 1
3: 62
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901794674 Original CRISPR TACCCACTCCTCCCAGGGCC AGG Intronic
900188740 1:1344568-1344590 TCCCCAGGCCACCCAGGGCCAGG + Intronic
900427835 1:2588534-2588556 TACCCACTCCTGACAGGCCAAGG + Exonic
900604352 1:3517164-3517186 GACCCCCTCCTGGCAGGGCCAGG + Intronic
900962564 1:5934605-5934627 TCCCCACTGCTCCCAGTCCCGGG + Intronic
901026207 1:6279937-6279959 AACCCATTCCTCTCAGAGCCTGG - Intronic
901186753 1:7378590-7378612 TCCCCACTCCTCCCTGCCCCCGG - Intronic
901325084 1:8360860-8360882 TCCCCAGGCCTCCCAAGGCCAGG - Exonic
901639947 1:10688079-10688101 TGCCACCTCCTCCCCGGGCCTGG - Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
901845700 1:11980641-11980663 CGCCCCCTCCTCTCAGGGCCGGG - Intronic
902040973 1:13492118-13492140 TTCCCCCTCCTCCCAGGCACAGG + Intronic
902335158 1:15750285-15750307 TACCCACTTTACGCAGGGCCTGG - Intergenic
902872290 1:19321868-19321890 TATCCACTTGTCCCAGCGCCAGG + Intronic
903443030 1:23402496-23402518 TACCCATCCCTCCCACTGCCGGG + Intronic
903834079 1:26191409-26191431 TACCAACTCCTACCTGGACCAGG + Exonic
903857050 1:26343742-26343764 TACCCACCCCTCCAGGGGCAGGG + Exonic
903857489 1:26345512-26345534 TGCCCACTCACCCCGGGGCCCGG - Exonic
904575236 1:31501283-31501305 TCCCCACTCCCCACAGGCCCTGG - Intergenic
904913956 1:33956322-33956344 TTCCCCCTCCTCCCAGGCCCTGG + Intronic
905706564 1:40064346-40064368 TAGCCACCCAGCCCAGGGCCTGG - Exonic
905960356 1:42037337-42037359 TCCCCCCTCCTCCCAGTCCCTGG - Intergenic
906480871 1:46198241-46198263 TCTCTCCTCCTCCCAGGGCCCGG + Intronic
906633539 1:47392231-47392253 TCCCCAATCCTCCCAGCCCCTGG - Intergenic
907732438 1:57080223-57080245 TCCCTACTCCTCCCAGCCCCTGG + Intronic
908176244 1:61558050-61558072 CTTCCACTCATCCCAGGGCCAGG - Intergenic
908584109 1:65550193-65550215 GACCGACACCTCCCACGGCCGGG - Intronic
909688747 1:78380756-78380778 TCCCCACTCCTCCCAGTTCCTGG + Intronic
910210411 1:84786806-84786828 TCCCCTCTCCTCCCAGCCCCTGG - Intergenic
912062292 1:105687536-105687558 TACCCCCTGTTCCCAGGTCCGGG + Intergenic
912414406 1:109498313-109498335 TCCCCCTTCCTCCCAGGGCTGGG - Intronic
912429275 1:109620593-109620615 TTCCCCCTCCTCCCAGAGCTGGG + Intronic
915145475 1:153793879-153793901 TGTCCCCTCCTCCCAGGGCCAGG - Intergenic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
915497364 1:156291609-156291631 TACCCCCTACTCCGAGGGCGAGG - Exonic
915540305 1:156561897-156561919 TCCTCACCCCTCGCAGGGCCAGG + Exonic
916138857 1:161676073-161676095 TACACACTCCCACCTGGGCCAGG - Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
918088421 1:181265077-181265099 TACCTACCTCTCCCTGGGCCCGG + Intergenic
919471540 1:197985345-197985367 TACCCACTCCACCCAGCCCCTGG - Intergenic
919779760 1:201214184-201214206 GGGCCACTTCTCCCAGGGCCTGG + Exonic
920264363 1:204710820-204710842 GCCCTACTCATCCCAGGGCCAGG - Intergenic
920415273 1:205795300-205795322 GGCCCACTCCCCCCAGGGCTGGG + Intronic
920513707 1:206568717-206568739 AAGCCACTCCTCTCAAGGCCTGG + Intronic
921070463 1:211654135-211654157 TCCCCCCTCCTCCCACTGCCTGG - Intergenic
921708682 1:218352032-218352054 TGCACACCTCTCCCAGGGCCAGG - Intronic
921741318 1:218688135-218688157 TAACCACTCCTCCCATGGGTAGG - Intergenic
921779232 1:219141843-219141865 TTTCCTCTCTTCCCAGGGCCTGG + Intergenic
922774729 1:228209386-228209408 TACCCGCTCTTCCCAGGCCAAGG + Intronic
922805155 1:228382526-228382548 TTCTCCCTCCTCCCAGGCCCTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923625268 1:235608529-235608551 TTCCCGCTCCTCCCAGATCCTGG + Intronic
924706937 1:246509607-246509629 TCCCCGCTCTTCCCAGGGCTGGG + Intergenic
924708464 1:246516580-246516602 TACGGGCTCCTCCCTGGGCCAGG + Intergenic
1063100446 10:2945520-2945542 TACCTGCTCTGCCCAGGGCCTGG + Intergenic
1064431916 10:15278736-15278758 TTCCCACACCTCCCAGCCCCTGG - Intronic
1067833228 10:49622053-49622075 GAGCCCTTCCTCCCAGGGCCTGG - Intronic
1068338056 10:55664079-55664101 TTCCCTCTCCTCCCAGTCCCTGG - Intergenic
1069894523 10:71672327-71672349 TACCGCCTCCTCCCAGGCCCAGG + Intronic
1069948451 10:72003009-72003031 TGGCCACCCCTCCCAGGTCCAGG - Intronic
1070569646 10:77631402-77631424 TCCCCACACGGCCCAGGGCCTGG + Intronic
1071402238 10:85285157-85285179 TCCCCACTGCTCCCAGAGCGAGG - Intergenic
1073072425 10:100803141-100803163 TACCTTCTCTGCCCAGGGCCTGG - Intronic
1076217715 10:128710084-128710106 TCCCCAGACCACCCAGGGCCCGG + Intergenic
1076539705 10:131206364-131206386 TGCCCAGGCCTCCCAGGCCCTGG + Intronic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1077038048 11:504612-504634 TTCCCACTCCCCCCTGGGTCGGG + Intronic
1077042645 11:531353-531375 GCCCCTCCCCTCCCAGGGCCCGG - Intergenic
1077090197 11:774964-774986 TCCCCACTCCTCCCAGGCCGCGG + Intronic
1077119677 11:901113-901135 AACCCACCCCTCCCTGGCCCAGG + Intronic
1077119961 11:902648-902670 AACCCACCCCTCCCTGGCCCAGG + Intronic
1077171316 11:1167432-1167454 TACCCTCACCTCCCAGGTCATGG + Intronic
1078454374 11:11463697-11463719 TTCCCTATCCTGCCAGGGCCTGG - Intronic
1078581705 11:12544007-12544029 TACCCACTGCTGCCAGCCCCAGG - Intergenic
1080242770 11:30146017-30146039 CACCCCTTCCTCCCAGGCCCTGG - Intergenic
1080764975 11:35287653-35287675 CCCCCACTCCTCCCAGGCCTGGG + Intronic
1081485816 11:43527711-43527733 TTCCCACTCAACCCAAGGCCAGG - Intergenic
1081669965 11:44937346-44937368 TTTCCACGCCTCCCAGGGTCTGG - Exonic
1081793266 11:45804011-45804033 TCCCCGCCCCTTCCAGGGCCGGG - Intergenic
1081909178 11:46689345-46689367 TCCCCACTCCTCCCAGTACCTGG - Intronic
1084006726 11:66327015-66327037 CACCCACCCCACCCAGGGCCAGG - Intergenic
1084063230 11:66689054-66689076 CCCCCACTCCCCACAGGGCCTGG + Intronic
1084270334 11:68026089-68026111 TACCCACTCCTCCAAAAGGCAGG - Exonic
1084608870 11:70188076-70188098 TTCCCGCTCCCACCAGGGCCCGG + Exonic
1084615602 11:70233858-70233880 TACTCCCTCTCCCCAGGGCCTGG + Intergenic
1084642111 11:70432171-70432193 TACCACATCCCCCCAGGGCCCGG - Intronic
1084643324 11:70438885-70438907 TGCCCACTCCACGCAGGCCCTGG - Intergenic
1084939866 11:72606774-72606796 TACCCACCCCTCCCTCTGCCTGG - Intronic
1085038259 11:73312334-73312356 TCCCCAATTCTCCCAGGCCCAGG - Intronic
1085305577 11:75483820-75483842 TCCCCAATCCTCCCAGCCCCTGG - Intronic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1086805685 11:91239495-91239517 TCCCTATTCCTGCCAGGGCCAGG + Intergenic
1087762019 11:102111347-102111369 TCCCCACTCCTCCCAGAGTCCGG + Intronic
1088833122 11:113555029-113555051 TACTCACCTCCCCCAGGGCCTGG + Intergenic
1089260689 11:117221927-117221949 TACCCCCTCCTCCCAGCCCCAGG - Intronic
1089528583 11:119112550-119112572 TGCCCACTCACCCCAGGGCCAGG + Exonic
1089644209 11:119867456-119867478 TTCCCCCTCCTCCCAGGTCCTGG - Intergenic
1089649341 11:119902184-119902206 TACCCATCCCTGCCTGGGCCAGG + Intergenic
1089731280 11:120520640-120520662 CACCACCTCCTCCAAGGGCCTGG + Intronic
1090057770 11:123438330-123438352 TGCCCTATCCCCCCAGGGCCTGG + Intergenic
1090774035 11:129947481-129947503 TACCAACTCCTTCCAGGCCCTGG + Intronic
1091909893 12:4221091-4221113 TCCCCACTTCTCCCAGCCCCTGG + Intergenic
1092087420 12:5774691-5774713 GACCCAGCCCTCCCAGGGACAGG + Intronic
1092736616 12:11588787-11588809 AACCTTCTCCTCCCAGGTCCAGG + Intergenic
1092841176 12:12542462-12542484 TTCCCACTCCTCCCAGCCCCTGG - Intronic
1092954886 12:13540806-13540828 TCCACACTCCTCCCTGGGGCCGG - Exonic
1093037666 12:14348041-14348063 TCCCCACTTCCCCCAGGCCCTGG + Intergenic
1093090122 12:14911356-14911378 CAGCCACTCCACCCAGGGCCAGG + Intergenic
1095406097 12:41869133-41869155 TACCCACTCTGCCCATGGTCTGG - Intergenic
1095947924 12:47764398-47764420 TTCCAACTCATCCCAGGCCCAGG + Intronic
1096494845 12:52033933-52033955 TACCCCCGCCCCCGAGGGCCAGG + Intronic
1096616225 12:52834804-52834826 CCACCACTCCTCCCAGGTCCAGG + Intergenic
1097170399 12:57109773-57109795 TACCCAGTCCTCCCTGAACCTGG - Intronic
1100338977 12:93660034-93660056 CTCTCAGTCCTCCCAGGGCCAGG + Intergenic
1101386478 12:104262557-104262579 TACGTAATCTTCCCAGGGCCTGG + Intronic
1102205977 12:111091183-111091205 TTCCCACTCCAGCCAGGGCCAGG + Intronic
1102487422 12:113267761-113267783 TGCCCAACCCTCCCAGGACCTGG - Intronic
1102932583 12:116874021-116874043 TGCCCACTCCCCTCAGTGCCAGG - Intronic
1103342507 12:120228604-120228626 TCCCCACTGCGCCCATGGCCAGG - Intronic
1103962052 12:124615164-124615186 TGCCCCCTCCCCCCAGGCCCTGG + Intergenic
1104234638 12:126921613-126921635 TACTCCCTCCTCCCAGGCCCTGG - Intergenic
1104785053 12:131443918-131443940 TCCCCACCCTTCCCAGGCCCAGG + Intergenic
1104989523 12:132617954-132617976 TCCACACTCCTCCCATGCCCTGG - Intergenic
1105327934 13:19387223-19387245 AACCCACGCTTCCCAGGCCCAGG - Intergenic
1105412356 13:20181405-20181427 TCCCCTCTCCTCCCAGCCCCTGG + Intergenic
1105863973 13:24442470-24442492 AACCCACACTTCCCAGGCCCAGG + Intronic
1106137734 13:26986675-26986697 ACCACACTTCTCCCAGGGCCAGG - Intergenic
1106772431 13:32974800-32974822 TATCCTCTGCTCCCAGGCCCTGG + Intergenic
1107537150 13:41346640-41346662 TACCTAATCATCCCAGAGCCAGG - Intronic
1107859972 13:44651338-44651360 TCTCCACTCCTTCCAGAGCCTGG + Intergenic
1107925010 13:45250559-45250581 TACCCACTTCTGCCAGGCACTGG - Intronic
1109059777 13:57599907-57599929 AACCCCCTCCTCCCAGGTTCAGG - Intergenic
1109507436 13:63323565-63323587 TACATCCTCCTCCCAGGACCTGG - Intergenic
1110837830 13:80105358-80105380 TACCCACACCTCTCAGCCCCTGG + Intergenic
1113537766 13:111081863-111081885 CACCCAGTCCTCCTAGGGCATGG + Intergenic
1113786956 13:113006956-113006978 CACCCTCTCCCCCAAGGGCCGGG - Intronic
1113917800 13:113884508-113884530 TACCCGGCCATCCCAGGGCCCGG + Intergenic
1114236902 14:20831978-20832000 TACCCACCAAGCCCAGGGCCAGG - Intergenic
1114639705 14:24211363-24211385 AAGCCACTCTTCCCAGTGCCTGG + Intronic
1116861825 14:50001454-50001476 TACCCATTTCTCCCGGGGCATGG - Intronic
1118471439 14:66078520-66078542 TCCCCTCTCCTCCCAGCCCCGGG + Intergenic
1118557213 14:67038283-67038305 TTCCCTCTCCTCCCAGCCCCTGG - Intronic
1118708005 14:68497686-68497708 TTCCCCCTCCTCCCAGCTCCTGG + Intronic
1118990926 14:70796366-70796388 GAGCCACACGTCCCAGGGCCTGG + Intronic
1119391710 14:74295451-74295473 CATCTCCTCCTCCCAGGGCCTGG + Intronic
1120145320 14:80972769-80972791 TCCCCACTCCTCCCAGCCCCTGG + Intronic
1121122620 14:91385491-91385513 AACCCTCACCTCCCAGGGCTGGG - Intronic
1122061882 14:99141380-99141402 TCCCCATTCATCCCAGGGCTAGG + Intergenic
1122092002 14:99347117-99347139 GTCCCACCCCTGCCAGGGCCAGG + Intergenic
1122244742 14:100394544-100394566 TCCCCTCTGATCCCAGGGCCTGG - Intronic
1122270189 14:100565522-100565544 CTCCCACACCCCCCAGGGCCTGG - Intronic
1122274824 14:100586166-100586188 CCCCCACTACTCCCAGGGCCAGG - Intronic
1122293819 14:100693939-100693961 TACCCACCCCTCCCAAGCACTGG + Intergenic
1122962821 14:105105433-105105455 TTCCCCCTCCTCCCAGCTCCTGG - Intergenic
1123172568 14:106388532-106388554 TTCCCTCACCTCCCAGGTCCTGG - Intergenic
1123179593 14:106456793-106456815 TTCCCTCTCCTCCCAGGTCGTGG - Intergenic
1123213854 14:106787937-106787959 TTCCCTCTCCTCCCAGGTCCTGG - Intergenic
1124658159 15:31525074-31525096 TCCCCACTCCTCCCTGTCCCTGG + Intronic
1125751739 15:42033791-42033813 GGCCCACTCCACCCAGGGCCAGG - Intronic
1126549323 15:49909237-49909259 TGACCACTCCTCCCAGAGACTGG + Intronic
1126846730 15:52766977-52766999 TGTCCACCCCTCCCAGGCCCAGG - Intronic
1127069683 15:55276640-55276662 TTCCCCCTCCTCCCAGTCCCTGG - Intronic
1128796844 15:70472494-70472516 TCCCCAGTCACCCCAGGGCCAGG + Intergenic
1129144268 15:73633139-73633161 GGCTCCCTCCTCCCAGGGCCAGG - Exonic
1129194239 15:73954706-73954728 CACACACCCCTCCCTGGGCCTGG - Intergenic
1129648094 15:77456596-77456618 TGCCCACGCCTCCCAGGTTCAGG - Intronic
1129656031 15:77526404-77526426 GTCCCTCTCCTCACAGGGCCTGG - Intergenic
1129759141 15:78118834-78118856 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
1130289045 15:82580678-82580700 TACCCTCTCCTCCTAGCCCCTGG + Intronic
1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG + Intronic
1130844941 15:87735641-87735663 CCCCCACTCCTCACAGGGACCGG + Intergenic
1130893700 15:88154164-88154186 TGCCCACTTCTCCAAGAGCCAGG + Intronic
1131193885 15:90339549-90339571 TACCCCCTTCTCCCAGCCCCTGG - Intergenic
1131739257 15:95369703-95369725 TACCCCCTACTGCAAGGGCCAGG + Intergenic
1132224273 15:100128347-100128369 TTCCCACTCCTCCCAGCCGCAGG - Intronic
1132603990 16:786050-786072 TCCGCACTCCTGCCTGGGCCCGG - Exonic
1132688628 16:1172548-1172570 TACCCACTGCTCCCACGCCTCGG - Intronic
1132815498 16:1824404-1824426 CACCCACTCCTCCCAGCTCTTGG - Intronic
1133236402 16:4389270-4389292 TTCCCTCTCCTCCCAGGGGCCGG - Intronic
1134876358 16:17702520-17702542 TTCCTACTCCTCTCAGGCCCTGG - Intergenic
1135702223 16:24642413-24642435 AACCTACTCCTCCCAGAGGCTGG - Intergenic
1136519145 16:30785237-30785259 CACCCAGTCCTCCCACAGCCTGG + Intronic
1137272080 16:46908419-46908441 TGCACACGCCTCCCAGGGCCTGG + Intronic
1137547808 16:49416358-49416380 TGACCTCTCCTCCCAGGGCTGGG - Intergenic
1139680758 16:68560288-68560310 TCCCCACTCCTCTCAGTACCTGG + Intronic
1139940809 16:70604178-70604200 TCCCTGCCCCTCCCAGGGCCTGG - Intronic
1141004510 16:80339696-80339718 TATCCAATCCTCCCAGGGGCAGG + Intergenic
1141686295 16:85571801-85571823 TGCCAGCTCCTCCCTGGGCCTGG - Intergenic
1141967203 16:87453459-87453481 TATCCCCTCTTCCCAGGGCTGGG - Intronic
1142141180 16:88473532-88473554 GCCCCACTTCTCCCATGGCCGGG + Intronic
1142753973 17:2004665-2004687 TGCCCTCTCTGCCCAGGGCCAGG - Intronic
1143772823 17:9179345-9179367 ACCCCACTCCTCCCATGCCCTGG + Intronic
1144598954 17:16596496-16596518 TCCCCCCTCCTCCCAGGCTCTGG - Intergenic
1144834608 17:18150413-18150435 CACCCACTGCCCCCAGGACCTGG + Exonic
1147219270 17:38919124-38919146 TACCCACACATTCCAGGGCTGGG + Exonic
1147649289 17:42053049-42053071 TGCCCACTCCCACCATGGCCAGG + Intronic
1147664019 17:42134170-42134192 TACCCTCTCCTCCCAAGCCTGGG + Intronic
1147958712 17:44153007-44153029 ACCCCACCCCACCCAGGGCCTGG - Intronic
1147972960 17:44229624-44229646 GACCCACTCCACCCAGTGTCTGG - Intergenic
1147991203 17:44334537-44334559 TAGCCACCCCTCCCAGGGGAAGG + Intergenic
1149300948 17:55304299-55304321 CACCTCCTCCTCCCTGGGCCGGG - Intronic
1149439342 17:56661988-56662010 TCCCCTCACCACCCAGGGCCAGG + Intergenic
1149520833 17:57317203-57317225 TAGCCACGCCTGCCATGGCCAGG + Intronic
1149922110 17:60669638-60669660 AAGACACTCCTACCAGGGCCAGG - Intergenic
1149999304 17:61423363-61423385 TACCCTCTCCTCCCAGCCCCTGG - Intergenic
1150197157 17:63311921-63311943 TCCTCACTCCTCCCAGTCCCTGG - Intronic
1150225470 17:63522639-63522661 TACCCCCTCCTCTCAGGACCAGG + Intergenic
1150710018 17:67523104-67523126 TACCCACTCTTTCCAGTCCCTGG + Intronic
1151228507 17:72664701-72664723 TCCCCATTCCACTCAGGGCCAGG + Intronic
1151678159 17:75610463-75610485 TGCCTACTCTCCCCAGGGCCTGG + Intergenic
1151731547 17:75914384-75914406 CACCACCTCCTCCCAGGGGCAGG - Intronic
1152077981 17:78170265-78170287 TCCCCACCCCTCCCCGGTCCAGG + Intronic
1152146013 17:78569351-78569373 TACCCCTTCCTCGCAGGGCGAGG - Intronic
1152313991 17:79569239-79569261 TCCCCACTCCCCCCAAGCCCTGG + Intergenic
1152431795 17:80252380-80252402 TACCCTCCCATCCCACGGCCAGG - Intronic
1153174378 18:2354474-2354496 TACCCCCTCCTCCAAGCCCCTGG + Intergenic
1154037054 18:10813408-10813430 TCCCTTCTCCTCCCAGGCCCTGG + Intronic
1154161193 18:11981707-11981729 GAAGCACTCCTCCCAGGGGCCGG - Exonic
1155311979 18:24532918-24532940 CACCCAGTCCTCCCAGGGTGGGG + Intergenic
1155659832 18:28235307-28235329 TACCTTCACCTCCCAGGTCCCGG - Intergenic
1156474635 18:37397859-37397881 CGCCCACTCCACCCAGGGTCTGG - Intronic
1157331669 18:46708593-46708615 TCCCCACTCACCCCAGGGCCAGG + Intronic
1157850596 18:51045792-51045814 TTCCCCTTCCTCCCAGGCCCTGG + Intronic
1158727457 18:59986521-59986543 GACCCATTCCCTCCAGGGCCTGG + Intergenic
1159173625 18:64805622-64805644 TTTCCCCTCCTCCCAGGCCCTGG - Intergenic
1159912163 18:74155994-74156016 TGTCCACTCCTCCCAGGGAAGGG - Intronic
1161398697 19:4058395-4058417 GACACAGTCCCCCCAGGGCCCGG - Intronic
1161756983 19:6141369-6141391 TCTCCTCTCCTCCCAGGCCCAGG + Intronic
1161777298 19:6270511-6270533 TCTTCACTCCTCCCAAGGCCAGG - Intronic
1162381892 19:10336021-10336043 CACCCACTCACCCCAGGGACTGG + Intronic
1162793314 19:13074058-13074080 TCTCCACTCCCCCCAGGGCCAGG + Intronic
1163012597 19:14434699-14434721 TACACAGCCCTCCCTGGGCCGGG - Intronic
1163304840 19:16471656-16471678 TGTCCTCTCCGCCCAGGGCCCGG - Intronic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163399191 19:17081841-17081863 GACCCACTCCGCCCTGGGCTGGG - Intronic
1163548499 19:17952529-17952551 AACCCCCTCCTCACAGGGCATGG - Intronic
1163596933 19:18225889-18225911 TTCCCCCTCCTCCCACTGCCAGG + Intronic
1163645234 19:18485510-18485532 GCCCATCTCCTCCCAGGGCCAGG + Intronic
1163748479 19:19061720-19061742 TACCTCCCCCTCCCAGGGCCTGG + Intergenic
1163780391 19:19243948-19243970 TACCTCCGCCTCCCAGGTCCCGG - Intronic
1163884332 19:19952524-19952546 TCCACACTCCTCCCAGGACTAGG - Intergenic
1163908914 19:20171399-20171421 TCCACACTCCTCCCAGGACTAGG + Intronic
1163913300 19:20215603-20215625 TCCACACTCCTCCCAGGACTAGG - Intergenic
1163914829 19:20231910-20231932 TCCACACTCCTCCCAGGACTAGG - Intergenic
1163920885 19:20287451-20287473 TCCGCACTCCTCCCAGGACTAGG + Intergenic
1163929732 19:20377561-20377583 TCCACACTCCTCCCAGGACTAGG + Intergenic
1163959156 19:20671110-20671132 TCCACACTCCTCCCAGGACTAGG + Intronic
1163969773 19:20780925-20780947 TCCACACTCCTCCCAGGACTAGG + Intronic
1164006001 19:21150183-21150205 TAACCAGTTCACCCAGGGCCTGG - Intronic
1164027680 19:21367798-21367820 TCCACACTCCTCCCAGGACTAGG + Intronic
1164237233 19:23347798-23347820 TACCCACTAAGCCCAGGGCCAGG + Intronic
1164563343 19:29309059-29309081 TACACACTTCTCCCAGGGAGGGG + Intergenic
1165022286 19:32934780-32934802 TCTCCACTCCTACCAGGGCAAGG - Intronic
1165220515 19:34312452-34312474 TGCCCTCTCCTCCCAGCTCCTGG + Intronic
1165309849 19:35023332-35023354 TACCCACTCACCCCTTGGCCAGG - Exonic
1165332846 19:35150960-35150982 TACCACCTCCTCCCTGGCCCTGG - Intronic
1165407904 19:35642079-35642101 CACCCCCTCCCCCAAGGGCCTGG - Exonic
1165598623 19:37033366-37033388 TACTCTCTCCTCCCAGTACCTGG + Intronic
1166398564 19:42460966-42460988 TACCCAGTCCTCCTAGATCCTGG + Intergenic
1166610193 19:44184924-44184946 TCCCCCCTCCTCCCAGCCCCTGG + Intergenic
1167166973 19:47804960-47804982 TACCCACTCCTCCTGGCTCCTGG + Intronic
1167174864 19:47858808-47858830 TACCCACTCCTCCCGGCTCCCGG - Intergenic
1167466509 19:49653277-49653299 TGCCCGCTCCTCCCCGGACCAGG - Exonic
1167648297 19:50717387-50717409 TGGCCCCTCATCCCAGGGCCGGG + Intronic
1168106462 19:54168489-54168511 TAACCCCCACTCCCAGGGCCTGG - Exonic
926028124 2:9562419-9562441 TTCCCCCTCCTCCCAGTCCCTGG + Intergenic
926116712 2:10218079-10218101 TCCCCACTGCTGCCAGTGCCCGG + Intergenic
926768684 2:16348705-16348727 TACCCCCTCCTCCCAGCTTCTGG - Intergenic
927894975 2:26775774-26775796 TACCCACCTCACCCAGGGCTTGG - Intronic
928172070 2:29010398-29010420 TCGCCATTGCTCCCAGGGCCAGG - Intronic
929240330 2:39647233-39647255 TACCCTAACCACCCAGGGCCAGG - Intergenic
929488217 2:42373752-42373774 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
929557080 2:42932214-42932236 GCCACCCTCCTCCCAGGGCCTGG - Intergenic
930570891 2:53085543-53085565 TTCCCACACCTCCCAGTCCCTGG - Intergenic
931066753 2:58596363-58596385 TTCCCACTGCTCCTAGGGCTAGG - Intergenic
932055253 2:68436968-68436990 AACCCACTCCTCCCAATGGCAGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
933046716 2:77547139-77547161 TAACCACTCCTCCCAGCCCCTGG - Intronic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
933777507 2:85779889-85779911 CACCCCATCCTCCCAGGGCCTGG - Intronic
933837322 2:86256474-86256496 GCCCCAATCATCCCAGGGCCAGG + Intronic
934084319 2:88497349-88497371 TACCCACTGCATCCAGGGGCAGG + Intergenic
934756485 2:96828083-96828105 TTGCCACTCCTCCCAGGGCAGGG + Exonic
935010079 2:99126088-99126110 TACCCACTCCTCCCACACCAGGG - Intronic
935661919 2:105474148-105474170 TTCCCCCTCCTCCCAGGCCCTGG + Intergenic
936089681 2:109492957-109492979 AACCCAGTCCCCCAAGGGCCTGG - Intronic
936263011 2:110978487-110978509 TACCCACACCTCTGAGGGCTGGG - Intronic
936363406 2:111828773-111828795 TTCCCCTTCCTCCCAGGCCCTGG - Intronic
936470625 2:112795791-112795813 TACCTGCTCCCCCCAGGCCCTGG - Intergenic
936524643 2:113234427-113234449 GACCTTCTCCTCCCTGGGCCAGG + Intronic
936996753 2:118423926-118423948 GAGCCAGTCCTCCCAGGGCAGGG + Intergenic
937413817 2:121698657-121698679 TCCCCTCTCCTCTCAGGTCCTGG - Intergenic
940005561 2:149006769-149006791 TTCACTCTCCTGCCAGGGCCAGG - Intronic
941529772 2:166653298-166653320 TCCCCACTCCTCCCAGCACCTGG + Intergenic
942550519 2:177111240-177111262 TACCCACTCCTTCCAGCTCCTGG - Intergenic
942629776 2:177942873-177942895 TTCCCCCTCCTCCCAGCCCCTGG + Intronic
943727729 2:191269162-191269184 TACTCTCTCCTCCCAGCCCCTGG + Intronic
944703533 2:202266097-202266119 TTCTCCCTCCTCCCAGAGCCCGG - Intronic
946404093 2:219483619-219483641 CACCCAGGCCTCCCCGGGCCAGG - Exonic
947712845 2:232325828-232325850 ACCCCACTCCTCCCAGCACCAGG - Intronic
947732527 2:232439271-232439293 AACCCGCTCCTCCCAGCACCAGG - Intergenic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
947814643 2:233028247-233028269 TACCCAGTCCCCTCAGCGCCTGG - Intergenic
948874601 2:240820012-240820034 CACCCACTGCGCCCAGGGCGGGG - Intronic
949041907 2:241853405-241853427 GCCACACTCCTCCCAGGGCTGGG - Intronic
1168773705 20:431938-431960 TCCCCTCTCTTGCCAGGGCCTGG + Intergenic
1168879421 20:1194073-1194095 TGGACACTCCTTCCAGGGCCTGG - Intergenic
1171460941 20:25297575-25297597 CACCCCCACCTCCCAGTGCCAGG - Exonic
1172865844 20:38096570-38096592 TATCCCCTACTCCCAGGCCCTGG + Intronic
1172952209 20:38729419-38729441 TTCCCACGCCTCCCAGCGCCAGG - Intergenic
1172970681 20:38871057-38871079 CACCCACACCTCCGAGGTCCTGG - Intronic
1173475328 20:43355129-43355151 TGACCACACCTCCCAGTGCCAGG + Intergenic
1173654268 20:44688983-44689005 TTCCCCCTCCTCCCAGCTCCTGG - Intergenic
1173809313 20:45946647-45946669 TTCTCACTCCTCTCAGGGCCTGG - Intronic
1174363547 20:50043050-50043072 TCCTCACTCCTCCCAGACCCTGG - Intergenic
1175264281 20:57693146-57693168 ACCCCACGCCTCCCAGGGCCAGG + Intronic
1175966891 20:62664358-62664380 GCCCCACTTCTCCCAGGGGCTGG + Intronic
1176305241 21:5119720-5119742 TACCCACTCCCGACAGGCCCAGG + Intronic
1176991630 21:15504438-15504460 TCCTCACTCCTCCCAGCCCCTGG + Intergenic
1178690594 21:34746642-34746664 TACCAACACTGCCCAGGGCCTGG + Intergenic
1179484997 21:41704383-41704405 AAGCGACTCCTCCCTGGGCCTGG - Intergenic
1179502044 21:41816051-41816073 CACTCACTCCTGCCAGGGCCTGG + Intronic
1179851813 21:44142310-44142332 TACCCACTCCCGACAGGCCCAGG - Intronic
1180003237 21:45004572-45004594 TGCCCCCTCCTCCCAGCCCCGGG + Intergenic
1180061606 21:45388189-45388211 TTCCCTCTTCTCCCAGGACCAGG - Intergenic
1180163371 21:46007709-46007731 TTCCCACTCCTCCCAGGAGCTGG + Intergenic
1180875243 22:19172034-19172056 CACCCCCTCCTCTCGGGGCCCGG - Intergenic
1181624551 22:24114381-24114403 TTCCCACTCTGGCCAGGGCCAGG + Intronic
1181636554 22:24177412-24177434 CACCCGCTCCCCCCAGGTCCTGG - Intronic
1181801480 22:25350626-25350648 CGCCCCCTCCTCCCAGGGGCAGG + Intergenic
1182058876 22:27382475-27382497 TACCCATCCCTCCCAGCCCCTGG + Intergenic
1182136081 22:27904455-27904477 TACCCACTCCTCCCAGTGCCTGG - Intronic
1182249103 22:28985355-28985377 TAGCAACTCCTCCCCGGGCTTGG + Intronic
1182675642 22:32036929-32036951 TTCCCCCTCCTCCCAGCCCCTGG - Intergenic
1182694214 22:32185744-32185766 TCCCCACTCCCCACATGGCCGGG - Intergenic
1183293555 22:37017367-37017389 TACCCCTACTTCCCAGGGCCAGG - Intronic
1184484145 22:44765957-44765979 TTCCCAGTCCTCCCTGCGCCAGG - Intronic
1184524178 22:45011990-45012012 TACCCACTCCTCCCACTTCTGGG + Intergenic
1185039365 22:48496616-48496638 CACCCACTCCACCCAGAGCTGGG + Intronic
1185222869 22:49637624-49637646 AGCGCACTCCTCCCAGGCCCCGG - Intronic
1185273903 22:49941706-49941728 CACCCTCTGCTCACAGGGCCGGG - Intergenic
1185284898 22:49995793-49995815 TACACACTCCTCTTGGGGCCAGG - Exonic
949413535 3:3792765-3792787 TACCCAGTCATTCCAGGCCCAGG - Intronic
950646653 3:14381453-14381475 TCCCCACTTCTCCCAGCTCCAGG - Intergenic
952582912 3:34855586-34855608 TGCCTAGTCATCCCAGGGCCAGG - Intergenic
952925542 3:38316844-38316866 CTCCCTCTCCTCCCAGGGACAGG + Intronic
953877977 3:46677090-46677112 CCCCCACCCCTCCAAGGGCCTGG - Intronic
953926627 3:46985888-46985910 TGGCCACTCCTCCCAGGCCCTGG + Intronic
954700140 3:52446613-52446635 TGCCTCTTCCTCCCAGGGCCAGG + Intergenic
955412856 3:58667139-58667161 GCCCCACACCTCCCAGCGCCTGG - Intergenic
957146715 3:76434410-76434432 TAGCCACCCAGCCCAGGGCCTGG - Intronic
958487285 3:94729129-94729151 TAGCAACTCATGCCAGGGCCTGG + Intergenic
960993518 3:123326553-123326575 TACCCACATCTCTCAGTGCCTGG - Intronic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
961505640 3:127369103-127369125 TACCCTATACCCCCAGGGCCAGG - Intergenic
962344785 3:134610995-134611017 TGGCCAGTCCTCCCTGGGCCAGG - Intronic
962530799 3:136277943-136277965 AACCCATACCTCCCAGGGGCAGG - Intronic
962828417 3:139119467-139119489 CACCCACTCATCCCTGGGCCAGG - Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
966855857 3:184193471-184193493 TGACCACTCCTCCCAGGCCTCGG + Intronic
966919944 3:184604599-184604621 CACACTCTCCGCCCAGGGCCCGG - Intronic
966963698 3:184968037-184968059 TCCCCTCTCCTCCCAGCCCCTGG + Intronic
968100952 3:195965011-195965033 TCCCCTCTCCTCCCATGGGCTGG - Intergenic
969125913 4:4947888-4947910 TACAAACCCCTCCCTGGGCCTGG + Intergenic
969516793 4:7652508-7652530 CGCCCACTCCTCCCAGGTCTAGG + Intronic
970193199 4:13533964-13533986 TACCTACCCCTCTGAGGGCCTGG - Intergenic
970425042 4:15938185-15938207 TTCTCACTCCACCAAGGGCCTGG - Intronic
975228200 4:71899342-71899364 CACCCACTCCTCCCAATGCACGG - Intergenic
976299665 4:83506112-83506134 TACCCACCAAGCCCAGGGCCAGG - Intronic
976793707 4:88909426-88909448 TCCCCACTCCTCCCAACCCCTGG - Intronic
980296804 4:130929769-130929791 TACCCCCTCCTCTCAGGCCCTGG + Intergenic
980351480 4:131690767-131690789 TTCCCTCACCTCTCAGGGCCAGG - Intergenic
980811425 4:137886409-137886431 TTTCCACTTCTCCCAGGCCCTGG + Intergenic
981998534 4:151001335-151001357 CACCCAATCATTCCAGGGCCTGG + Intronic
982436271 4:155385131-155385153 GCCCCTCTCTTCCCAGGGCCGGG - Intergenic
984777268 4:183492742-183492764 CACCCACTCCACACGGGGCCAGG + Intergenic
984838266 4:184042412-184042434 TCTCCACTCCTCCCAGCTCCTGG + Intergenic
985502135 5:254904-254926 TCCCCTCTCCTCCCACGGGCTGG + Intronic
985734885 5:1573763-1573785 TCCCCTCTCCTCCCACGGGCTGG - Intergenic
985775666 5:1840529-1840551 GACACACTCGTCCCAAGGCCTGG - Intergenic
985778706 5:1858549-1858571 AGCCCACTCCTCCCTGGGCCAGG + Intergenic
986339147 5:6774764-6774786 CGCCCACTCCTCCAAGAGCCCGG + Intergenic
986569009 5:9146119-9146141 TACCCACCCTGCCCAGGGTCTGG + Intronic
987158994 5:15120596-15120618 CACCCCCTCCTCCCAATGCCAGG + Intergenic
987289265 5:16492961-16492983 GAGCGACTCCTCCCAAGGCCAGG + Intronic
988659234 5:33246579-33246601 TGCGCACTCCTCCCAGTGGCAGG - Intergenic
989184443 5:38609758-38609780 TACCCACTCCCCTCAGTCCCAGG + Intergenic
989608463 5:43269015-43269037 TAGCCACTCCTACCCGGGCACGG + Intronic
990760335 5:59122383-59122405 TACACACTCCTCCCAGGCTCTGG - Intronic
992369088 5:76124268-76124290 TCCCCACTTCTCCCAGATCCTGG + Intronic
995778802 5:115754324-115754346 TTTACACTCCTCTCAGGGCCAGG - Intergenic
997881864 5:137598945-137598967 TAACGACTCCCCCCAGGGCCTGG + Intergenic
998072945 5:139212758-139212780 TTCCCCCTCCTTCCAGTGCCTGG + Intronic
999023332 5:148195104-148195126 TACCCACTTTCCCCAGGCCCTGG + Intergenic
999433075 5:151540537-151540559 TACCCACTCCACCCCTCGCCAGG + Intronic
1001032545 5:168273174-168273196 TACCCTGTCATCTCAGGGCCTGG - Intergenic
1001289676 5:170447946-170447968 TACCCAGTCATCCAAGGGTCAGG + Intronic
1001481633 5:172092853-172092875 TTCCCACTCCTACCTGGCCCTGG + Intronic
1001997487 5:176173888-176173910 CTCCTGCTCCTCCCAGGGCCCGG - Intergenic
1002326434 5:178411614-178411636 TTCCCCCTCCTCCCAGCTCCTGG - Intronic
1002451968 5:179324129-179324151 TACCCCGTCCTCCCAGGCCTAGG - Intronic
1002536864 5:179880518-179880540 GTCCCACTCCACCCAGGGCTGGG + Intronic
1002908846 6:1472480-1472502 ACCCCACTCCTCCCAGCCCCTGG - Intergenic
1004213032 6:13671625-13671647 CACTCACTCCTCCCAGTTCCAGG - Intronic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1005655964 6:27937776-27937798 ACTCCACCCCTCCCAGGGCCAGG - Intergenic
1006152548 6:31997075-31997097 TACCCACCCCCGCCAGAGCCCGG - Intronic
1006158854 6:32029812-32029834 TACCCACCCCCGCCAGAGCCCGG - Intronic
1006303201 6:33204854-33204876 TGCCCTCTCCTCCCCGTGCCCGG + Intronic
1006359361 6:33578878-33578900 CACCCCCACCGCCCAGGGCCTGG + Intronic
1006430925 6:33995218-33995240 AACCAGCACCTCCCAGGGCCCGG - Intergenic
1006436032 6:34026620-34026642 TACCCACTCCTGCCAGAGGAGGG - Intronic
1007990439 6:46249613-46249635 TGCCCACCCCTCCCTAGGCCTGG - Intronic
1010787758 6:80024584-80024606 TCCCCACTGCTCCCAGCCCCTGG - Intronic
1011506868 6:88054978-88055000 TCCCCCCTCCTCCCAGCTCCTGG + Intronic
1012949655 6:105504454-105504476 TTCCCACCCCTGCCACGGCCAGG - Intergenic
1013606259 6:111751733-111751755 TACCTACGCCTCCCAGTACCTGG + Intronic
1015469139 6:133583589-133583611 TCCCCTCTCCTCCCATGCCCTGG - Intergenic
1015733328 6:136370743-136370765 TTCCCCCTCCCCCCAGGCCCTGG - Intronic
1015941029 6:138452133-138452155 TCTCCATTCCTCCCAGGACCAGG - Intronic
1016292661 6:142541199-142541221 TAGCCACTAAGCCCAGGGCCAGG + Intergenic
1016824982 6:148379903-148379925 TCACCACCCCTCCCAGGCCCAGG + Intronic
1016930757 6:149405730-149405752 TACCCTCTTCTCCCAGCCCCTGG - Intronic
1017200291 6:151745893-151745915 TTCCTTCTCCTCCCAAGGCCTGG + Intronic
1018758755 6:166872266-166872288 TGCCCACTCCAGCCTGGGCCAGG - Intronic
1018765907 6:166932470-166932492 GAACCACTCCCCTCAGGGCCTGG + Intronic
1019216733 6:170448579-170448601 GGCCCACGCCTGCCAGGGCCTGG - Intergenic
1020254433 7:6494812-6494834 TCTCCCCTACTCCCAGGGCCTGG - Intergenic
1022508659 7:30921973-30921995 TACCCAGGCCTCCCAGGCCCAGG - Intronic
1025147351 7:56516310-56516332 CACCTACTTCTCCCAGGGCATGG - Intergenic
1025775611 7:64558313-64558335 TCCACACTCCTCCCAGGACTAGG - Intronic
1025865809 7:65379580-65379602 CACACACTCCTCCCAGGACTAGG + Intronic
1026050802 7:66945107-66945129 CACCCAGTCCCCCCAGGCCCTGG + Exonic
1027045923 7:74991429-74991451 TACCCACCCCACCCCAGGCCAGG + Intronic
1029581946 7:101442140-101442162 TACAGAGTCCACCCAGGGCCCGG - Intronic
1031163109 7:118192490-118192512 TACCCACACCTCTCAGTGCTAGG - Exonic
1034442817 7:151095588-151095610 TCCCCACCCCTTCCTGGGCCTGG + Intronic
1037796911 8:22003379-22003401 TACACATTTCTCCCAGGGCTTGG - Intronic
1037798577 8:22017789-22017811 TTTCCTCTCCTCCCAGTGCCTGG - Intergenic
1037816504 8:22115396-22115418 TCCCCACTCCTCCGAGACCCAGG - Exonic
1037845619 8:22279425-22279447 TATCCACCCATCCCAGTGCCAGG + Exonic
1037927313 8:22853826-22853848 TCCCAACTCCTCCTAAGGCCTGG - Intronic
1038127824 8:24693820-24693842 TACCCACTCACACCATGGCCTGG - Intergenic
1038320635 8:26523473-26523495 TCCCCTCTCCTCCCAGCCCCTGG + Intronic
1038450130 8:27634253-27634275 CCCCCGCTCCACCCAGGGCCTGG + Intronic
1039598900 8:38816879-38816901 TCCCCACTCCTTCCAGGGAGGGG - Intronic
1039638199 8:39189760-39189782 TACCCACTCTTCCCAGTCTCTGG + Intronic
1039975928 8:42364778-42364800 TACCCCCTCCTTCCAGGCCCTGG - Intronic
1041195798 8:55400370-55400392 TACCCATACCTCCCAGGTTCTGG + Intronic
1041453393 8:58031965-58031987 TCCCCATTCCTGCCAGGGCATGG - Intronic
1042158466 8:65868446-65868468 TACCCACCAAGCCCAGGGCCAGG + Intergenic
1045421471 8:102020908-102020930 TACACACTGCTCCCTTGGCCAGG + Intronic
1045505970 8:102779010-102779032 TCCCCTCTCCTCCCAGGGCCTGG - Intergenic
1047260067 8:123248225-123248247 TCCCCATTCCTCCCAGCCCCTGG - Intronic
1047794748 8:128243066-128243088 TTCCTCCTCCTCCCAGGCCCTGG + Intergenic
1048001532 8:130383249-130383271 GAAGCACTCCTCCCAGGGGCTGG - Intronic
1048255819 8:132904509-132904531 TAGCCACTCCTCCCTGGCCGTGG + Intronic
1048527921 8:135221524-135221546 TTCCCACTCATCTCTGGGCCGGG - Intergenic
1048793174 8:138123087-138123109 GACCCAATCCTCCAAGGGTCCGG + Intergenic
1048888911 8:138931086-138931108 TCCCCGCCCCTCCCAAGGCCCGG + Intergenic
1049514023 8:143044096-143044118 TCCCCAGTCCTCCCATGGCCTGG + Intronic
1049566616 8:143343548-143343570 TGCCCACTCTTCCCGAGGCCGGG - Intronic
1049659347 8:143812755-143812777 CCCACGCTCCTCCCAGGGCCAGG + Intronic
1051590973 9:18776765-18776787 TTCGCTCTCCTTCCAGGGCCCGG + Exonic
1053004406 9:34594434-34594456 GACCCCCTCCCCCCAGGGTCAGG + Intergenic
1053363236 9:37504472-37504494 TACCTCCGCCTCCCATGGCCTGG + Intergenic
1053878075 9:42563527-42563549 TACCCCCTCCTCCCAGCCCCTGG + Intergenic
1053894585 9:42730840-42730862 TACCCCCTCCTCCCAGCCCCTGG - Intergenic
1054233619 9:62538167-62538189 TACCCCCTCCTCCCAGCCCCTGG - Intergenic
1056546778 9:87620210-87620232 TTCCCTCTCCTCTCAGGGCCAGG + Intronic
1056972331 9:91216752-91216774 CACCCCCTCCTCCCAGGCCTGGG + Intronic
1057126372 9:92619141-92619163 TACCCACACATCTCAGGGGCTGG + Exonic
1057350210 9:94290405-94290427 TCCCCACTCCCCCCAGCCCCTGG + Intronic
1057606786 9:96504159-96504181 TGCCCGCTCCTCCCACAGCCTGG - Intronic
1057896955 9:98916818-98916840 GAGCCCCGCCTCCCAGGGCCAGG - Intergenic
1060397265 9:123325014-123325036 CCCCCAGGCCTCCCAGGGCCAGG - Intergenic
1060425459 9:123501102-123501124 TTCCCTCTCCTCCCAGCACCTGG + Intronic
1061149984 9:128823067-128823089 AACGCCCACCTCCCAGGGCCAGG + Intronic
1061536599 9:131254155-131254177 TACCCTGTCCTCCCCGGTCCGGG - Intergenic
1061754323 9:132802297-132802319 TTGCTACTCCTCCCAGGGCAGGG + Intronic
1062123802 9:134848705-134848727 AATCCACACCTCCCAGGGCTGGG + Intergenic
1062187638 9:135227180-135227202 TGCCTCCTCCTCCCTGGGCCTGG + Intergenic
1062310133 9:135930972-135930994 CACCCACGCCCCCCAGAGCCAGG + Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062339452 9:136087512-136087534 GAGCCAGTCCTCGCAGGGCCCGG + Intronic
1185456023 X:311300-311322 CACCCACTCAGCCCAGGGGCCGG - Intronic
1188016034 X:25109615-25109637 TGCCCACTCCTGCCAGGCCCAGG + Intergenic
1189338117 X:40183176-40183198 CAGCCAGGCCTCCCAGGGCCAGG - Intergenic
1189901170 X:45707842-45707864 TCCCCACTCCTCCCAGCCTCTGG - Intergenic
1190095647 X:47478077-47478099 TACCCCCTCCTCTCAGCCCCTGG - Intronic
1190259331 X:48788053-48788075 TGCCCACCCCTCCCATGGCAGGG - Intronic
1190301158 X:49058411-49058433 TACCCTTTCCTCCCAGGGCAAGG - Intronic
1190337663 X:49272028-49272050 TTCCCAGTCCTCCCAGGAACAGG - Intronic
1191151383 X:57223604-57223626 TACCCACCAAGCCCAGGGCCAGG + Intergenic
1192148075 X:68694941-68694963 TACCCCCAAGTCCCAGGGCCTGG + Intronic
1192559477 X:72116614-72116636 TCCCCACTCCACTCAGGGGCAGG + Intergenic
1193087774 X:77462708-77462730 TACCCCCTCCTCCTAGTCCCTGG + Intergenic
1194408520 X:93528279-93528301 TACCCACTTATCCCACGACCAGG + Intergenic
1195641200 X:107176507-107176529 TACCCATTCCTCCCAGCCCCTGG - Intronic
1196694430 X:118595895-118595917 TTCCCTCTCCTCCCAGCCCCTGG - Intronic
1197142378 X:123131145-123131167 TACCCACCAAGCCCAGGGCCAGG + Intergenic
1197171357 X:123438151-123438173 TTCCCTCTTCTCCCAGGTCCTGG + Intronic
1197851141 X:130861614-130861636 TTCACTCTCCTCCCAGGCCCTGG - Intronic
1197893521 X:131288376-131288398 CTCCCACTCCTCTCAGGGCCAGG + Intronic
1197994481 X:132358102-132358124 TACCAACTCCCCCCAGTCCCTGG - Intergenic
1198140949 X:133803000-133803022 AACCTCCTCCTCCCAGGTCCTGG + Intronic
1198427891 X:136538048-136538070 TTCCCACCCTTCACAGGGCCAGG + Intronic
1198738541 X:139814681-139814703 TTCTCCCTCCTCCCAGGCCCTGG - Intronic
1200018834 X:153185070-153185092 TTCCCACTCCTCCCAGCCCGTGG + Intergenic
1200099740 X:153684684-153684706 TAACCAGTCACCCCAGGGCCCGG + Intronic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200227053 X:154423830-154423852 TCCCCCATCCTCCCAGGCCCTGG - Intergenic