ID: 901796140

View in Genome Browser
Species Human (GRCh38)
Location 1:11680807-11680829
Sequence GAGGGGGCGCGGGCGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 549}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901796140_901796148 -5 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796148 1:11680825-11680847 CCCTCGCCCCGCTGTCTCGCGGG 0: 1
1: 0
2: 0
3: 10
4: 100
901796140_901796150 -4 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796150 1:11680826-11680848 CCTCGCCCCGCTGTCTCGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 71
901796140_901796156 27 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796156 1:11680857-11680879 CCACAGCTGTGCCCCCGAAAAGG 0: 1
1: 0
2: 1
3: 14
4: 122
901796140_901796151 -1 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796151 1:11680829-11680851 CGCCCCGCTGTCTCGCGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 58
901796140_901796146 -6 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796146 1:11680824-11680846 CCCCTCGCCCCGCTGTCTCGCGG 0: 1
1: 0
2: 0
3: 11
4: 125
901796140_901796157 28 Left 901796140 1:11680807-11680829 CCACTGGCCGCCCGCGCCCCCTC 0: 1
1: 1
2: 6
3: 59
4: 549
Right 901796157 1:11680858-11680880 CACAGCTGTGCCCCCGAAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901796140 Original CRISPR GAGGGGGCGCGGGCGGCCAG TGG (reversed) Intronic