ID: 901797940

View in Genome Browser
Species Human (GRCh38)
Location 1:11691492-11691514
Sequence CGCCGCCGCCGCGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 369}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901797940_901797955 27 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797955 1:11691542-11691564 ACTCAGAGCGCAGCTGGCGAGGG 0: 1
1: 0
2: 0
3: 11
4: 107
901797940_901797952 21 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797952 1:11691536-11691558 CCCAGAACTCAGAGCGCAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 229
901797940_901797948 -2 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797948 1:11691513-11691535 CGCCTAGGCCTCTGGGGAGCTGG 0: 1
1: 0
2: 2
3: 22
4: 297
901797940_901797954 26 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797954 1:11691541-11691563 AACTCAGAGCGCAGCTGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
901797940_901797947 -8 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797947 1:11691507-11691529 CGGCGGCGCCTAGGCCTCTGGGG 0: 1
1: 0
2: 0
3: 7
4: 83
901797940_901797946 -9 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797946 1:11691506-11691528 GCGGCGGCGCCTAGGCCTCTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
901797940_901797945 -10 Left 901797940 1:11691492-11691514 CCCGCGCCCTCGCGGCGGCGGCG 0: 1
1: 0
2: 6
3: 59
4: 369
Right 901797945 1:11691505-11691527 GGCGGCGGCGCCTAGGCCTCTGG 0: 1
1: 0
2: 0
3: 23
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901797940 Original CRISPR CGCCGCCGCCGCGAGGGCGC GGG (reversed) Exonic
900101203 1:962875-962897 CCCCGGCGCTGCGAGGGGGCCGG + Exonic
900201070 1:1406858-1406880 CGCAGGGGCCGCGAGTGCGCTGG + Intronic
900237544 1:1599937-1599959 CGCGGCCGCCCCGACGCCGCCGG - Exonic
900310058 1:2029278-2029300 CGCCGCTGCTCCGAGGGAGCTGG + Intronic
900349743 1:2228685-2228707 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
900485316 1:2920011-2920033 CGCCGCCGTCCCGAGGGCTTTGG - Intergenic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
901526016 1:9823868-9823890 CGCCGCCGCCGCCGTGACGCTGG + Exonic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
902050331 1:13559164-13559186 AGCCTCCGCCCCGAGGGCTCAGG - Intergenic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
902690931 1:18109787-18109809 CAGCGCCGCCGAGAGGGCACTGG + Intronic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
903153340 1:21428424-21428446 CGCCGCCGCCGGGCGCGCCCAGG - Intergenic
903220132 1:21864882-21864904 CTCCTCCACCTCGAGGGCGCGGG + Exonic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
903628113 1:24745663-24745685 CCCCGCAGCCGGGAGGGAGCCGG - Intronic
903750045 1:25616257-25616279 CGGGGCAGCCGCCAGGGCGCGGG + Intergenic
903750175 1:25616684-25616706 CGCCGCCGCCGCGCCGCAGCCGG - Intergenic
903750323 1:25617173-25617195 CTCCGCCGCGGAGAGGGCGCCGG - Intergenic
904039387 1:27575469-27575491 CGCCTCCGCGGCGAGGGTGGTGG - Intronic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
905308251 1:37033521-37033543 AGCAGCCGCAGCGAGGTCGCAGG - Intronic
905580696 1:39081363-39081385 AGCCGCTGCCGCTAGGGCGCGGG + Intronic
905734602 1:40316750-40316772 CGCCGCCTCCCAGGGGGCGCCGG - Intronic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
907364169 1:53945976-53945998 CGAGGCCGCCGCGAGGGGGCGGG - Intergenic
907429965 1:54406049-54406071 CGCCGCCGCCGCTACCGCTCCGG + Exonic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
912505037 1:110150555-110150577 AGCCGGCGCTGCCAGGGCGCAGG + Exonic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921702602 1:218284904-218284926 CGCCGCAGCAGCTAGGACGCGGG - Intergenic
921909083 1:220528292-220528314 CGCCGCCGCCGCTGGGCCCCGGG + Intronic
922766411 1:228158708-228158730 GGCCGCCGCAGGGAAGGCGCAGG - Exonic
924732427 1:246724304-246724326 CGTCGCCGCAGCCAGCGCGCCGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1063395670 10:5685065-5685087 CGCCGGTGTCGCGAGGGCCCGGG + Exonic
1063426326 10:5952917-5952939 CGCCTCCTGCGCGAGGGAGCAGG - Exonic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1064167792 10:13001582-13001604 CGCCGCCGCCCCGTGCGCCCCGG - Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064418201 10:15168603-15168625 CAGCGCCGCCGCGATGGCGGAGG - Exonic
1067028703 10:42866120-42866142 CCCGGCCGCCGCGAGCTCGCGGG + Intergenic
1067416401 10:46106396-46106418 CGCCGCGGCCCCCAGGGCCCAGG + Intergenic
1069698356 10:70404351-70404373 CGCCGCCGCCGCCTGCCCGCCGG + Intergenic
1069837658 10:71319385-71319407 CGCAGCCGCCCCCAGGGCCCGGG - Intronic
1070098191 10:73358866-73358888 TGCAGCCGGCGCTAGGGCGCAGG - Intergenic
1072059740 10:91798476-91798498 CTCCGCCGCCGCGGGGCAGCCGG + Exonic
1072638889 10:97196241-97196263 CGCCGCTGCCCCGACGCCGCGGG - Intronic
1073122646 10:101131871-101131893 CGCCGCCGCCGCCAGGACCGGGG - Exonic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075699762 10:124461799-124461821 CGCGGCCGCGGCGCCGGCGCCGG + Intergenic
1075748431 10:124743982-124744004 CGCCGCCGCCGCCCGGCCCCGGG + Intronic
1076844210 10:133061017-133061039 GGCCCCCGCCGGGAGGGCACAGG - Intergenic
1076869663 10:133187169-133187191 CGCTGCCTCCGCGGGGACGCTGG + Intronic
1076992102 11:280718-280740 CGCCGCCCCCGGGAGGCTGCAGG + Exonic
1077105954 11:842732-842754 TGCCGCGGCCGCGCGGGCCCGGG - Intergenic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1078233211 11:9461126-9461148 CGCCGCCGCGCTGAGGGCGGCGG - Intronic
1078514299 11:12009215-12009237 CGCTCCCGCCGGGAGGCCGCCGG + Intronic
1078631542 11:13008899-13008921 CGCCGCTGCCTCGAGGGACCAGG + Intergenic
1079451204 11:20601262-20601284 CGCCGCCGCCACGTGTGCCCAGG + Exonic
1079459769 11:20669503-20669525 CGCCGCCGCCGCGCCAGCGGTGG + Intergenic
1081699946 11:45146700-45146722 CGCCGCCGCCGCGCCGAGGCTGG + Intronic
1081774058 11:45665716-45665738 CGCCCCAGCCGCGAGCGCCCTGG + Intergenic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083659803 11:64246777-64246799 CGGCTCCGCGGCGAGGGCGGCGG + Exonic
1083747696 11:64744805-64744827 CGCAGCCGCAGCGAGGCCGGCGG - Intronic
1084295677 11:68212638-68212660 CGCAGCGGCCGCGGGGTCGCCGG + Intronic
1084331632 11:68433774-68433796 CGCCGTCGCAGCGCAGGCGCAGG - Exonic
1085561267 11:77474205-77474227 CGCCGCCGCCGCGCCGGGGAGGG - Intronic
1086724670 11:90167420-90167442 AGCGGCCGCGGCGGGGGCGCAGG - Intronic
1087138112 11:94740505-94740527 CGCCGCCGCCGCGCGCCCTCGGG + Intronic
1088462111 11:110093101-110093123 CGCGGCCGCCGCTAGGGCGCGGG - Intergenic
1090344995 11:126062654-126062676 AGCCGCCGCCGCGCGCGCGCGGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091381884 12:67134-67156 TGCCGCCGCCGCCAGGGCCCAGG + Exonic
1091718416 12:2795540-2795562 CTCCGCCGCCCCGCGCGCGCCGG - Intronic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1092256314 12:6928249-6928271 CGCCGCCGCGACGACGGCGGCGG - Intronic
1092727682 12:11500720-11500742 CGCCGCCACCGCCGGGGCCCAGG + Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1096493029 12:52023363-52023385 TGCCGCCGCCGCGAGTGGGGTGG + Intronic
1096675481 12:53223485-53223507 AGCCGCCGCCGCCAGGGCCCAGG - Intronic
1096983734 12:55743390-55743412 CGCCGCCGCCGCGGGGCCCTCGG - Exonic
1097227672 12:57488138-57488160 GGCCGCCGCCGGGAGAGCCCGGG + Exonic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1099128282 12:78794167-78794189 GTCCGCCGCCCCGAGGGCTCCGG + Intergenic
1101144798 12:101830874-101830896 CTCCGCCGCGCCGAGGGCGTGGG - Exonic
1102136892 12:110583038-110583060 CGCCGCCCCCCCGAGGAGGCGGG + Exonic
1103261632 12:119593817-119593839 CGGCGGCGCCGGGAGGGCGGAGG - Exonic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103595608 12:122022731-122022753 CTCCGCAGACTCGAGGGCGCCGG - Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103779525 12:123389451-123389473 CGCCGCCGCCTCCACCGCGCGGG - Exonic
1104568087 12:129903231-129903253 CGCCGCGGCCGCCAGGGCCCGGG - Intronic
1105217511 13:18297711-18297733 CGCCGCCGCCTCCACCGCGCAGG - Intergenic
1106340264 13:28820311-28820333 CGCAGCCGCGGCGCGGGCGTGGG + Intergenic
1106735853 13:32586980-32587002 CGGCGGCGGCGGGAGGGCGCGGG - Intronic
1107467842 13:40665931-40665953 CACCGCCGCCGCCACGGAGCCGG + Exonic
1110318744 13:74136188-74136210 CGCGGGCGCAGCGAGGGCGTCGG + Intergenic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1113820279 13:113208731-113208753 CGGCCCCGCCGCGGGTGCGCAGG + Intronic
1114525673 14:23365850-23365872 CCCCTCCGCCGCCTGGGCGCAGG - Intergenic
1115235664 14:31207200-31207222 CCCCGCCGCCGGCAGGGCCCCGG + Exonic
1115399238 14:32939129-32939151 CGCCGCCGCCGCCACGGCCACGG + Intronic
1115851299 14:37592317-37592339 GGCCGCAGCCGCGCGGGCGGCGG - Exonic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1121453962 14:94026811-94026833 GGGCGCCGCCTCGACGGCGCTGG + Intronic
1121828906 14:97033327-97033349 CGCGGCGGCCGCGAGGACCCCGG - Intergenic
1122137859 14:99645134-99645156 CCCTGCCGCCGCGAGCGCCCCGG + Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122544959 14:102517103-102517125 CGCCCCCGGGGCCAGGGCGCTGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125577172 15:40763940-40763962 GTCCGCCGCCGGGAGGGCGGGGG + Intergenic
1125626831 15:41115987-41116009 CCCCGCCGCCGCGACGGCGGCGG + Exonic
1125752079 15:42036226-42036248 CGCCGCGGCCCCCAGGGCGGTGG - Intronic
1126592706 15:50355451-50355473 CCCCGCTGCCGCGCAGGCGCCGG - Intergenic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1128075716 15:64824136-64824158 CGCGGCCGCCCCGCGGGCCCTGG + Exonic
1128149849 15:65355898-65355920 CTCCGCCGCCGCGAGTGCGCCGG - Intronic
1129503246 15:76059912-76059934 CGGCGGGGCCGCGAGGGGGCGGG + Exonic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1131055344 15:89371543-89371565 GCCCGCAGCCTCGAGGGCGCGGG - Intergenic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131827006 15:96330389-96330411 CGCCGCCGCCGAGAGGGGGATGG - Intronic
1132342351 15:101086510-101086532 AGCCGCGGCCGCGCAGGCGCCGG - Intergenic
1132641872 16:981774-981796 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1132653145 16:1030625-1030647 CGCAGCGGCCGCCAGGGAGCGGG - Intergenic
1132877964 16:2148670-2148692 CGCCGCCGCCGCCAGGGGAAGGG + Exonic
1133040880 16:3059244-3059266 CGCCGCCGCCGCCCCTGCGCGGG - Exonic
1134588651 16:15434504-15434526 CTCCGCCGCCGCCAGCGCCCGGG - Exonic
1136261805 16:29082329-29082351 CGCCGCGGCCCCGAGTCCGCCGG - Intergenic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138651471 16:58463726-58463748 CGCCGCCGACGCGCGGGTGCAGG - Intronic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1140223187 16:73058440-73058462 CGCCGCCACCGCCCGGACGCGGG - Intronic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1142627859 17:1203617-1203639 CGCCGCCGCTGCGAGGAGCCCGG + Intronic
1142695017 17:1628748-1628770 CGCGGCCGGGGCGAGGGCGCGGG - Intronic
1142799734 17:2337628-2337650 CGCGGAGGCGGCGAGGGCGCGGG + Exonic
1143527265 17:7479699-7479721 CGCCGCCGCCGAGAGGAGGCCGG + Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1148157000 17:45430270-45430292 CGCCGCGGCTGCGATGGCGGCGG - Intronic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150326693 17:64263338-64263360 CGCCGCCAACCAGAGGGCGCGGG + Intergenic
1150484867 17:65536828-65536850 CGCCGCGGCCGCGAGGGTCATGG - Intronic
1150764626 17:67993546-67993568 CGCGGCGGCGGCGCGGGCGCGGG + Intronic
1151780269 17:76240661-76240683 CGCCCCCGCCGCGAGGCCCTGGG - Intergenic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152353638 17:79796797-79796819 CGCCGCCGCCGCCACGGCCGCGG + Intronic
1152742216 17:82023331-82023353 CGCGGCTGTCGCGAGGGCGGGGG + Exonic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1155507820 18:26549153-26549175 CGCGGGCGCCGAGAGGGTGCGGG - Exonic
1156242507 18:35267476-35267498 CGCCGCCGCCGGTAGAGCGAAGG - Exonic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1157867329 18:51197633-51197655 CGCCGCCGCCGCGCGCGCCGGGG - Intronic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1159586742 18:70289275-70289297 CGCACCCGCCGAGACGGCGCAGG - Intronic
1160454759 18:78992723-78992745 CGCGGCCGCCCCGAGCGCACCGG + Exonic
1160858935 19:1229506-1229528 GGCCGGGGCCGCGCGGGCGCCGG + Exonic
1160991864 19:1863391-1863413 CGGCCCGGCCCCGAGGGCGCGGG - Exonic
1161006770 19:1941114-1941136 CGCAGCCGCGGCCACGGCGCCGG - Intergenic
1161494913 19:4581471-4581493 CGCGGCCGCCGCGAGTGCGCGGG + Intergenic
1161628768 19:5340886-5340908 CGCCGCCGCCGCCGGGTCGGGGG + Intergenic
1162030922 19:7916929-7916951 CGCCGCCATCGCGGGTGCGCGGG + Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162145594 19:8610911-8610933 CGCCCCCGCCGCGTGGGAGGGGG + Intergenic
1164602036 19:29568647-29568669 GGCCGCTGCCTGGAGGGCGCAGG - Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164977016 19:32581115-32581137 CCGCGCCGCTGCCAGGGCGCCGG - Exonic
1165042836 19:33081156-33081178 GGCCGCCGTAGCGAGGGGGCGGG + Exonic
1165065423 19:33225668-33225690 CGCAGCAGCCGAGCGGGCGCGGG - Exonic
1165924953 19:39320961-39320983 CACCGCCGCCGCAAGGGGGGAGG + Intergenic
1166807585 19:45496630-45496652 CCCCGTCGCCGCCAGAGCGCGGG + Intronic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167258127 19:48443092-48443114 CGCGGCCACCGCGCGGGCGCCGG - Exonic
1168494878 19:56840055-56840077 CGCCGGCGCCGCGAGGCCGATGG + Intronic
1168609261 19:57786285-57786307 GGCCACCGCGGCGAGGACGCAGG - Intronic
926077159 2:9951174-9951196 CGCCCCCGCCGGGCGAGCGCAGG + Intergenic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927215502 2:20666208-20666230 CCCCGCCGCGGTGATGGCGCGGG - Intergenic
927215824 2:20667350-20667372 CGCCGCCGCCCCCTGGGCTCCGG - Exonic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
927904286 2:26846531-26846553 CCCCGCCGCCGGGAGGCCGCTGG + Intergenic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
927943317 2:27119064-27119086 CGCGGGCGCAGCGGGGGCGCTGG - Exonic
928093422 2:28390448-28390470 AGGCGCCGCCGGGAGCGCGCGGG - Intergenic
928094146 2:28393656-28393678 CGCGGCCGCGGCGAGGGCGGGGG + Exonic
932345883 2:70994884-70994906 CGCCGCCGCCGAGAGGAGCCCGG + Exonic
934296795 2:91748939-91748961 CGCCGCCGCCTCCAGCGCGCGGG + Intergenic
934661383 2:96145398-96145420 CGCCACCGCCACGAGAGCCCGGG - Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
935904392 2:107827422-107827444 GGCCGCGGCCGCGATGGCTCAGG + Intronic
936439956 2:112542688-112542710 CCTCGCCGCGGCAAGGGCGCCGG - Intronic
937083462 2:119156548-119156570 TGCCGCCGCCTCAAGGGCTCGGG + Exonic
938058334 2:128233385-128233407 CGTCGCCGCCGGGAGAGCGAAGG - Intergenic
939432654 2:142130777-142130799 CGCCGCCGCCGCCGGGCCGAAGG - Exonic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
942248171 2:174026031-174026053 CGCCTCCGCAGCCAGGGCCCAGG + Intergenic
943060675 2:183038571-183038593 CGCCGCCGCCGCTCTGGCCCTGG + Exonic
943580119 2:189674582-189674604 CACTGCCGCCGCCCGGGCGCGGG - Intronic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
944451758 2:199850943-199850965 CGCAGCAGCGGCGAGGGCGCGGG + Exonic
945241557 2:207681464-207681486 CGGCTCCGCGGCGAGGGCGGCGG - Intergenic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
946921466 2:224585298-224585320 CGCCGCCGCCGCCATCGCGGAGG - Exonic
947353600 2:229271170-229271192 CACCGCCGCCGGGTGGGCGTAGG + Exonic
947353632 2:229271304-229271326 CGCCGCCGCCGCGCGCTCGCCGG - Intergenic
947718206 2:232352284-232352306 CGCAGCGGCCGCAAGGGCGGCGG + Intergenic
947860514 2:233354511-233354533 CGCCGCCGCCGCCATGCTGCCGG - Exonic
948487206 2:238288582-238288604 CGCCGCCGGCGCGCGGGCCTCGG - Exonic
948645158 2:239400216-239400238 CGTCGCCGCTGCGAGCGCCCGGG - Intronic
1168878165 20:1185288-1185310 CGGCGCAGCCCGGAGGGCGCGGG + Intronic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169483357 20:6005838-6005860 CGACGTAGCCGCGAGGGGGCCGG - Intergenic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1170226306 20:13995324-13995346 CGCCGACGACGCTAGGGAGCTGG - Intronic
1170999197 20:21396610-21396632 CGCCGCGGCCGCGACGCCGCCGG + Intronic
1172274981 20:33674444-33674466 CGGCGCCGACGCGCGGGCTCAGG + Intronic
1173659701 20:44724818-44724840 CGCTGCCGCTGCGAGGACGGCGG + Exonic
1175252052 20:57615734-57615756 AGCCGCAGCTGCCAGGGCGCAGG - Intronic
1175968477 20:62671900-62671922 CGCCGTGGCCGGGTGGGCGCGGG - Exonic
1176194524 20:63831132-63831154 CGCGGCCGCCGGGCCGGCGCCGG + Intronic
1176283318 20:64327699-64327721 TGCCGCCGCCGCCAGGGCCCAGG - Intergenic
1176380689 21:6111018-6111040 CGCCCCCGCCGCCCGGGCGGGGG - Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1177157358 21:17513026-17513048 CGCCGCCGCCGCGAGCCAGTCGG + Exonic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178992482 21:37367203-37367225 CGCCGCCGCCGCCCGGGCCCCGG + Intronic
1179742783 21:43427222-43427244 CGCCCCCGCCGCCCGGGCGGGGG + Intergenic
1180908375 22:19431594-19431616 CGCGGCGGCCCTGAGGGCGCGGG - Exonic
1180960725 22:19761149-19761171 CGCGGCCGCAGCCAAGGCGCCGG + Exonic
1181006724 22:20016991-20017013 CGGCCCCTCCGCGAGGGGGCCGG - Intergenic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181478095 22:23180839-23180861 CGCCGCCGCCGCGCGGGCCATGG + Exonic
1181831583 22:25564689-25564711 CGCCGGCCCAGCGAGGCCGCTGG + Intergenic
1182296995 22:29315706-29315728 AGCCGCCGGCGCGAGCGAGCGGG + Exonic
1182576478 22:31276579-31276601 CGGCTCCGCGGCGAGGGCGGCGG - Intronic
1184644722 22:45889657-45889679 CGGCCCCGCCGGGAGGGCGAGGG - Intergenic
1184663711 22:45976941-45976963 CGCCACCGCCGCGTGAGCCCGGG + Exonic
1184680712 22:46071122-46071144 CGCCTCGGCCGCGCGGGCCCCGG + Intronic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185395099 22:50582767-50582789 CGCCTCGGCCGCCATGGCGCGGG + Exonic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
950903002 3:16513716-16513738 CGCCGCCGCCGCGCGTCCGCCGG + Intronic
953385080 3:42501831-42501853 CGCTCCCCACGCGAGGGCGCTGG + Intronic
953526051 3:43690970-43690992 AGCCGCCGCCGCGCAAGCGCCGG - Exonic
954063583 3:48088774-48088796 CGCCGCCGCCGAGACGGAGCTGG + Exonic
954333650 3:49903885-49903907 CTCAGCCGACCCGAGGGCGCCGG + Intronic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
954912784 3:54122679-54122701 CGCCGCCGCAGCGGGCGCGTCGG + Exonic
956761299 3:72447206-72447228 GGCCGGCGCCGCGAGGGCGGAGG + Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
963107639 3:141660325-141660347 CGCCGCAGTCTCCAGGGCGCCGG + Intergenic
967880327 3:194297184-194297206 CGCCGCCGCCGCCAGCTTGCTGG + Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967924184 3:194633377-194633399 CGCCGCCGCCGCCCGCGCCCGGG - Exonic
968046150 3:195624821-195624843 CGCTGCCGGCCCGAGGACGCGGG + Intergenic
968308504 3:197665266-197665288 CGCTGCCGGCCCGAGGACGCGGG - Intergenic
968642493 4:1721587-1721609 CGCCGCCGCCGCCAGGAAGGAGG - Exonic
968701305 4:2059409-2059431 CGCCGCCGCCGCGGGTCCGAGGG + Intergenic
968965176 4:3766026-3766048 CGGCGCCGCCGCGAGTCCTCCGG - Intergenic
970202880 4:13627489-13627511 CGCCGCCGCCGCCGGGCCCCGGG - Exonic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
971457808 4:26860792-26860814 CGCCGCGGCGGCGGCGGCGCGGG + Intronic
975778959 4:77819604-77819626 CGCCGCCGCCGCCCGGACCCCGG - Intronic
975870731 4:78776246-78776268 CGCCGCCTCCGCCAGTGCCCCGG - Intergenic
975986117 4:80202701-80202723 CGCCGCCGCCGCCAGCGTCCTGG - Exonic
978795716 4:112705907-112705929 CGCCGCGGCCCCGAGTCCGCCGG + Intergenic
979231503 4:118352908-118352930 CGCGGCCGCCGCCAGGGGACAGG - Exonic
979523871 4:121697222-121697244 CGCCGCTCCCCCGAGGGCCCCGG + Intergenic
979832319 4:125317211-125317233 CGCCGCCACCTGGAGGACGCTGG - Exonic
981429831 4:144645982-144646004 CGCCGCAGCAGGGAGGCCGCCGG + Intergenic
981782499 4:148444157-148444179 CGCCGCCGCCTCGCGTGCCCAGG - Intronic
982460799 4:155667226-155667248 TGCCGCTGCCGCGAGTGCCCAGG + Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984811094 4:183797356-183797378 CTCCGCCCCCGCGGGGCCGCTGG + Intergenic
985578050 5:682742-682764 CGCCACCCCCGCGTGGGCGTGGG - Intronic
985592977 5:774883-774905 CGCCACCCCCGCGTGGGCGTGGG - Intergenic
985747161 5:1654054-1654076 CGCTGCCGGCCCGAGGACGCGGG - Intergenic
986402790 5:7396049-7396071 CGCCGCCACCGCCACCGCGCGGG - Intergenic
988825327 5:34929742-34929764 CGCCGCCGCCGCTTCGGCCCGGG + Exonic
989043132 5:37249361-37249383 CTCCGCCGTCGCCAGGACGCAGG - Exonic
989103332 5:37839700-37839722 CGCCGCCGCCAACAGGGCGAGGG + Intergenic
989229985 5:39074473-39074495 CGTCGCCGCCGAGGGGGCGGGGG - Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992067457 5:73120711-73120733 CGCCGCCGGCGCAGGCGCGCGGG - Intronic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
993116159 5:83722248-83722270 CGCCGCCGCCGCTCGGGCTGTGG + Intergenic
993905740 5:93621299-93621321 CCCCGCCCCCTCGCGGGCGCGGG + Intronic
995650411 5:114362363-114362385 CGCCCCCGCCGCCGGGGCACCGG - Exonic
996379113 5:122845766-122845788 GGCCGCCGCCGCCTTGGCGCAGG + Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997975422 5:138439131-138439153 CGCCGCCGCCGCTCGGCCTCAGG + Exonic
998118990 5:139561186-139561208 CGCCGTCGCCGCCACGGCCCCGG - Exonic
998130408 5:139648792-139648814 CGCCGTCGCCGCGAGGCCGAGGG - Exonic
1001639130 5:173232893-173232915 CGCCGCCGCCGCCTGCCCGCAGG - Exonic
1002180178 5:177427108-177427130 CCCACCCGCCGCGAGGGCGGCGG - Intronic
1002524364 5:179807031-179807053 CGCCGGCGCCGCGAGGGGGTGGG + Intronic
1003645535 6:7910648-7910670 CGCCGCCGCCTCCTGGGCCCGGG + Exonic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1006304083 6:33208514-33208536 CACCGCCGCCGCCATGGCCCGGG - Exonic
1006337434 6:33427990-33428012 CGCCGCCGCCCCCACCGCGCCGG + Intronic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1006932645 6:37697147-37697169 CTCCGCCGCCGAGAGGTCCCCGG - Exonic
1007665354 6:43510144-43510166 CGCCGCCGCCGCGACCGCGAGGG - Exonic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1009437724 6:63636471-63636493 CCCCGCCGCCGCTGAGGCGCGGG + Intronic
1009905663 6:69867476-69867498 GGCCACCGCCGAGAGCGCGCCGG + Intronic
1010032897 6:71288841-71288863 CATGGCCGCGGCGAGGGCGCTGG - Exonic
1010703259 6:79077610-79077632 TGCCGCCGCCGGCAGGGCGCGGG - Intronic
1015244754 6:131063289-131063311 GGCTTCCGCCGCGAGGGGGCGGG - Exonic
1015843857 6:137497812-137497834 CGCCCCAGCCGCGAGGGCGCGGG - Intergenic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1016433137 6:144008419-144008441 CGCGGCCGCGAGGAGGGCGCTGG + Intronic
1016447653 6:144150150-144150172 CGTTGCCGCGGCGAGGACGCTGG - Intergenic
1016992793 6:149941653-149941675 CGCCTGCGCCGCGAGGTCCCTGG - Intergenic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017206397 6:151808104-151808126 CGCGGCCGCCGCCAACGCGCAGG + Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019404506 7:876638-876660 CGCCGCCGCCGCCATCGGGCCGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1020224950 7:6272571-6272593 CGCCGCCGGAGGGAGCGCGCAGG + Exonic
1020418120 7:7969158-7969180 CGCCGCCTCGGCGAGGGGGGAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021991901 7:26148275-26148297 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991924 7:26148322-26148344 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991947 7:26148369-26148391 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1022094543 7:27130538-27130560 CGCCGCCCGCGTGAGGGAGCTGG + Exonic
1022108439 7:27213371-27213393 GCCCGCGGCCGCGAGGGCTCCGG - Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1023382649 7:39623788-39623810 GTCCGCCGCCCCGAGGGCTCCGG - Exonic
1023405880 7:39833517-39833539 CGCCGCCGCCGCTACCGCTCCGG - Intergenic
1024579920 7:50793242-50793264 CGCCGCCTCCGCGTGGCTGCGGG + Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1028987667 7:97021113-97021135 CGCCGCCCCGGGGAAGGCGCGGG - Intronic
1029639821 7:101814103-101814125 CGCCGCCTCCCCGAGTGTGCAGG + Intergenic
1029927012 7:104328809-104328831 CGCCGCCGCCGCGATGCTCCCGG + Exonic
1030138704 7:106284573-106284595 CGCCGCCGCCGCGCGCCCCCAGG + Intronic
1030348147 7:108456016-108456038 CGCGGGCGCCGAGAGGGAGCAGG - Intronic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1032130756 7:129225361-129225383 CGCCGCCGTCGCGGTGCCGCTGG - Exonic
1032525585 7:132576739-132576761 CGCCGCCGCTGCTCGGGCTCCGG - Exonic
1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG + Exonic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1035169567 7:157010041-157010063 CGCCGCCGCCGCCCGCGCCCAGG + Exonic
1035553012 8:544649-544671 CGCCGCCGCCGCCCAGGCGCAGG - Exonic
1037535224 8:19817434-19817456 CGCCGCCGCCGCCACCGCGGGGG - Exonic
1037865641 8:22440727-22440749 CGGAGCCGCTGCGAGGCCGCAGG + Intergenic
1038023789 8:23571569-23571591 GGCGGCCGCGGCGAGGGCCCCGG - Exonic
1038311654 8:26449823-26449845 CGTGGCCGCGGCGATGGCGCGGG + Intronic
1038575508 8:28701155-28701177 CGCCGCTTCCGCAGGGGCGCCGG - Intronic
1039864590 8:41490299-41490321 TGCGGCCGGCGCGAGCGCGCGGG - Intergenic
1040055952 8:43056722-43056744 CGGCGCCGGCGCGAGACCGCGGG + Intronic
1041107044 8:54454131-54454153 CACCGCCGCCTAGACGGCGCCGG + Intergenic
1041449797 8:57994648-57994670 GGTCGCCGCCGCGGGGCCGCGGG - Exonic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1043502787 8:80873795-80873817 CGCCGCCGCCGCCTCGTCGCCGG - Intronic
1044340443 8:91040862-91040884 TGCCGCCTCCGGGAGGGCCCGGG + Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044934279 8:97278001-97278023 CGCCGCCGCTGCGGCTGCGCAGG + Intergenic
1046654120 8:116874440-116874462 TGGCGCCGCCGCTTGGGCGCCGG + Intronic
1048980937 8:139703208-139703230 CACCGCCACCGCGAGGCGGCTGG + Intergenic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1053306218 9:36986354-36986376 CGCCGCGGCCGCGCCGGCGGGGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056746761 9:89310438-89310460 CGCCGCCACCGCGCCGGCTCCGG + Intergenic
1057259655 9:93576640-93576662 CGCCGCGGCCGGGAGGGGACGGG - Exonic
1057313424 9:93955166-93955188 CGCCGCCGCCGCCAAACCGCGGG - Exonic
1057432322 9:95005242-95005264 CGCCGGCGCCACCGGGGCGCAGG - Intronic
1057463762 9:95292393-95292415 CGTGGCCGCCGGGACGGCGCGGG - Intronic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057489274 9:95508880-95508902 CGCCGCCGCCGCGGGGTCCGAGG + Intronic
1057489572 9:95510878-95510900 TGCCCCGGCCGCGCGGGCGCGGG - Intronic
1059145545 9:111896666-111896688 CGGCGCCGGCGAGAGCGCGCCGG - Intergenic
1059145550 9:111896681-111896703 CGGCGCCGCAGCGGGCGCGCGGG + Intergenic
1061208511 9:129177630-129177652 CGCCGCCGCCGCGCAGCCCCTGG + Exonic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061349559 9:130053854-130053876 CGCAGCCGCCGGAAGGGCCCGGG - Exonic
1062162466 9:135087822-135087844 CGCCGCCGCCCCGCGCGCCCCGG - Exonic
1062346722 9:136118485-136118507 CGCCGCCGCGGAGAGGGCACCGG - Exonic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1062653531 9:137590429-137590451 CGCCGCCGCCTCGCGCCCGCCGG + Exonic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1203773673 EBV:61493-61515 CGCCCCCGCCGCGACGGCTGTGG - Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1185457753 X:319231-319253 CGCCGCCGCCGCCGAGGCTCGGG - Intergenic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1187915444 X:24149477-24149499 CCCCGCCGCAGCGAGGCCACTGG + Intronic
1187915768 X:24150560-24150582 CACCGCCGCCGCCCGGACGCCGG + Intronic
1191213231 X:57910165-57910187 CGCCGCCGCCGCTAGGTTGATGG + Exonic
1194127753 X:90040989-90041011 CCCCGCAGCCGCCAGGGGGCGGG - Intergenic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1197753608 X:129981012-129981034 CGCTGCCGCCGCGCCGCCGCGGG - Intergenic
1198005498 X:132489414-132489436 CCCGGCCTCCGCGAGGGAGCTGG - Intronic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic