ID: 901798307

View in Genome Browser
Species Human (GRCh38)
Location 1:11692738-11692760
Sequence GACACACTGGTGTCTGGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 156}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901798291_901798307 23 Left 901798291 1:11692692-11692714 CCCTGCCCTATATGCTCCCTCCA 0: 1
1: 0
2: 1
3: 16
4: 250
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798299_901798307 -6 Left 901798299 1:11692721-11692743 CCACCTCCCAGCCCAGTGACACA 0: 1
1: 0
2: 3
3: 56
4: 528
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798292_901798307 22 Left 901798292 1:11692693-11692715 CCTGCCCTATATGCTCCCTCCAC 0: 1
1: 1
2: 0
3: 18
4: 233
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798293_901798307 18 Left 901798293 1:11692697-11692719 CCCTATATGCTCCCTCCACGCTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798290_901798307 24 Left 901798290 1:11692691-11692713 CCCCTGCCCTATATGCTCCCTCC 0: 1
1: 0
2: 5
3: 32
4: 356
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798300_901798307 -9 Left 901798300 1:11692724-11692746 CCTCCCAGCCCAGTGACACACTG 0: 1
1: 0
2: 1
3: 25
4: 289
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798296_901798307 6 Left 901798296 1:11692709-11692731 CCTCCACGCTGCCCACCTCCCAG 0: 1
1: 0
2: 7
3: 99
4: 700
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798297_901798307 3 Left 901798297 1:11692712-11692734 CCACGCTGCCCACCTCCCAGCCC 0: 1
1: 1
2: 9
3: 160
4: 1360
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798294_901798307 17 Left 901798294 1:11692698-11692720 CCTATATGCTCCCTCCACGCTGC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798295_901798307 7 Left 901798295 1:11692708-11692730 CCCTCCACGCTGCCCACCTCCCA 0: 1
1: 0
2: 5
3: 90
4: 794
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156
901798298_901798307 -5 Left 901798298 1:11692720-11692742 CCCACCTCCCAGCCCAGTGACAC 0: 1
1: 0
2: 6
3: 50
4: 435
Right 901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG 0: 1
1: 0
2: 0
3: 21
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901798307 Original CRISPR GACACACTGGTGTCTGGAAC CGG Intronic
901435651 1:9245867-9245889 GCAACTCTGGTGTCTGGATCTGG + Intronic
901671841 1:10860682-10860704 CACACACTGGTCTCTCGACCTGG - Intergenic
901798307 1:11692738-11692760 GACACACTGGTGTCTGGAACCGG + Intronic
902258688 1:15207556-15207578 GCCACTCTGATGTCTGGAGCTGG + Intronic
903601511 1:24544946-24544968 GACAAACTGGTATTTGCAACTGG + Intergenic
904220747 1:28966812-28966834 GAGACCCAGGTGGCTGGAACAGG + Intronic
909299143 1:73988965-73988987 AACACACTTGTGTGTGGAAGTGG - Intergenic
910050322 1:82965834-82965856 GACACATTGGAGACTGCAACTGG + Intergenic
911236613 1:95419044-95419066 GACACACTGGGGGTTGGAGCAGG - Intergenic
914258479 1:145979381-145979403 CACACACTGGTTTCTGTAACTGG - Intergenic
916078369 1:161216603-161216625 GACGCTCAGGTCTCTGGAACTGG - Intronic
917485795 1:175453467-175453489 GACACACAGGTTTCTGCAAAGGG + Intronic
918146263 1:181758635-181758657 GACACTCTGGTGTGTGGTACAGG - Intronic
919223695 1:194664870-194664892 CACACACTGGGGTCTGTCACGGG + Intergenic
919850465 1:201668755-201668777 CACACAATGGGGTCTGGAACAGG - Intronic
920365714 1:205447456-205447478 GACAGACTGGGGACTGGAACAGG + Intronic
921949380 1:220913977-220913999 GATGCACTGGTGTCTGGAAGTGG - Intergenic
1070787447 10:79170194-79170216 GACACACTGGTGCCTGCAAAGGG + Intronic
1070841253 10:79489521-79489543 GACACACTGCAGTGTGGAAAGGG + Intergenic
1071057730 10:81530552-81530574 GACACACTGGGGTATGGCAGAGG - Intergenic
1075703104 10:124481965-124481987 CACACAGTGGAGTCAGGAACAGG - Intronic
1076243136 10:128925483-128925505 GAAACACTGGTGACTGTCACTGG - Intergenic
1077007662 11:366065-366087 GACCCCCTGGTGTGAGGAACCGG - Intergenic
1079179076 11:18172855-18172877 GACACACTCGTGACTAGGACTGG - Exonic
1079268342 11:18957393-18957415 GACACACTCGTGACTAGGACTGG + Intergenic
1080033818 11:27689885-27689907 CACACACTGGGGCCTGGAGCAGG - Intronic
1081609606 11:44552795-44552817 GCCACACTGGGATCTGGGACTGG + Intergenic
1081646757 11:44795564-44795586 GACACACAGGTGTGAGGATCAGG + Intronic
1082987640 11:59182090-59182112 GACACACTGGGGACAGGAGCAGG - Exonic
1084319482 11:68365465-68365487 GACACACTGGAGGCTGTCACGGG + Intronic
1085288572 11:75380797-75380819 GACACCCTGGTATGAGGAACTGG + Intergenic
1085355498 11:75832843-75832865 GAAACTCTTGTGTCAGGAACTGG + Intronic
1087018927 11:93582643-93582665 GACACATAGGTCACTGGAACAGG - Intergenic
1088889781 11:114035528-114035550 TCCACACTGGTGTCTGACACTGG + Intergenic
1088926135 11:114305173-114305195 GAAGCACTGGTGTCTGGAGCAGG + Intronic
1088930051 11:114342246-114342268 CACACACTGGTGTCTGACATGGG + Intergenic
1090957924 11:131530178-131530200 GACCCTCTGGTGCCTGGCACAGG + Intronic
1091553412 12:1554030-1554052 GGCACAGTGGTGTATGGAAGGGG - Intronic
1092622297 12:10285431-10285453 GACAGAATGGTGACTGTAACAGG - Intergenic
1092675160 12:10909057-10909079 GCCATATTTGTGTCTGGAACAGG - Exonic
1092934455 12:13347549-13347571 GACACACAGTTGTCTGGAAGTGG + Intergenic
1093893316 12:24549321-24549343 GATTCAGTGGTGTGTGGAACAGG - Intergenic
1096171631 12:49476156-49476178 GACACACAGGTGGCTGGACGTGG + Intronic
1097222299 12:57458446-57458468 GACTCACTGGTCTATAGAACTGG + Intronic
1103217146 12:119210670-119210692 GACACATTGATGAATGGAACAGG - Intronic
1105327998 13:19387629-19387651 GATACGCTGGTGTGTGGGACTGG - Intergenic
1105614565 13:22000315-22000337 GACACACGGGTGGCTGGATGTGG + Intergenic
1107105302 13:36636642-36636664 GACACACTGGTGCCAGGAGTGGG + Intergenic
1107404340 13:40098640-40098662 GGCCCACTAGTGTCTGGAAGAGG - Intergenic
1112929054 13:104713063-104713085 GACACACTGGTGTGAGGAGTGGG + Intergenic
1114370743 14:22085078-22085100 GACACACTGGTGTCTTTGGCAGG + Intergenic
1115456944 14:33614536-33614558 GCCACACTGGTGTTTTAAACAGG + Intronic
1120019721 14:79515097-79515119 GACACACTGGTGCCTGTTACAGG + Intronic
1121215500 14:92244587-92244609 GACACACTGGTGTGAGGGATGGG + Intergenic
1122175107 14:99911496-99911518 GGCACACTGGTGTCGGGAGGTGG + Exonic
1123099920 14:105790687-105790709 GGCACACTGGTGTGAGGAGCGGG - Intergenic
1124506156 15:30276037-30276059 GAAAAACTGATGTCTGGAACTGG + Intergenic
1124737397 15:32262595-32262617 GAAAAACTGATGTCTGGAACTGG - Intergenic
1125405496 15:39349089-39349111 GAAATACAGGTGTCTGGAATTGG + Intergenic
1128717974 15:69922775-69922797 GGAACACTGGTGTCTGCAAATGG - Intergenic
1128720673 15:69945811-69945833 GAAACCCTGCTGTATGGAACTGG - Intergenic
1129957274 15:79650486-79650508 GACACACTGGGCACTGGACCAGG - Intergenic
1130160871 15:81398634-81398656 GACAAACAGGTGTCTGGAAAGGG - Intergenic
1132006840 15:98235045-98235067 GACACTCTGGTGGCTGGACCTGG + Intergenic
1132706722 16:1247184-1247206 GGCACGCTGGGCTCTGGAACGGG + Intergenic
1133431157 16:5738015-5738037 CACACACTGGTGCCTGGAGGGGG - Intergenic
1135387054 16:22051769-22051791 GACTGACTGGTGTCTGGGATGGG + Intronic
1135432814 16:22401028-22401050 GACACAGAGGTGTCTGAACCAGG - Intronic
1135731713 16:24900141-24900163 GACACTGTGGTGTCAGAAACTGG + Intronic
1135833366 16:25798875-25798897 GACAAACTCATGGCTGGAACAGG - Intronic
1136380570 16:29892782-29892804 AAGACAGTGGGGTCTGGAACAGG + Intronic
1137301477 16:47152464-47152486 GATACACTGGTGTTGGGAACAGG + Intergenic
1140343657 16:74190642-74190664 GACACACTTGTCTGTGGAACTGG + Intergenic
1142069347 16:88082412-88082434 GAAACACTGGTGTCTGCTCCTGG - Intronic
1149071053 17:52543815-52543837 GACACAATGCTGCCTGTAACAGG - Intergenic
1149599014 17:57881440-57881462 GACTCTCTGGTGCCTGGCACAGG + Intronic
1151727675 17:75894138-75894160 GAGACAGAGGTGGCTGGAACAGG - Intronic
1152452051 17:80387704-80387726 GACACTCTGTTGTCTGGTATGGG + Intronic
1156461005 18:37321298-37321320 GTCAGACAGGTGTCTGGAAAGGG - Intronic
1157344543 18:46813616-46813638 GAGACACTGGATTATGGAACAGG + Intronic
1160552600 18:79704592-79704614 GACACACGGGTGCCTGAGACAGG - Intronic
1160879331 19:1312460-1312482 GACAAGCTGGTGGCTGGAGCCGG - Intergenic
1161588139 19:5116712-5116734 CCCACCCTGGGGTCTGGAACTGG - Intronic
1162456175 19:10786383-10786405 GACACACTCATGTCTGGGAACGG - Intronic
1163198637 19:15745597-15745619 TACACACTGGGGTCTGTCACGGG - Intergenic
1163369085 19:16892138-16892160 GACGCACTGGTGTCTGAGATGGG + Exonic
1163991313 19:21001614-21001636 GACACACTGATGTATGGAAATGG + Intergenic
1164008535 19:21175584-21175606 CACACACTGGGGTCTGTCACGGG - Intronic
1164640770 19:29823994-29824016 CACGCACTGGTGTCTGGAGGTGG - Exonic
1164719452 19:30421764-30421786 GACACACTGGGGGCTGGAAGGGG - Intronic
1165901660 19:39172241-39172263 GACACCCGTGTGTCTGGAAATGG + Intronic
1166340583 19:42134547-42134569 AACACACTGGCAGCTGGAACAGG + Intronic
1166415403 19:42591717-42591739 GACACAGATGTGTGTGGAACAGG + Intronic
1166470738 19:43077599-43077621 GAAACACTTGTGTGTGGCACAGG + Intronic
1166740923 19:45114409-45114431 GCCCTCCTGGTGTCTGGAACAGG + Intronic
1168050943 19:53829432-53829454 GACAAAATGGTGTCTCTAACTGG + Intergenic
1168380973 19:55923194-55923216 CACACACTGGTGTCTGCTTCTGG - Intronic
925206726 2:2013492-2013514 GGCCCACTGGAGCCTGGAACCGG + Intronic
925628663 2:5867056-5867078 CCCACACTGTTGTCTAGAACAGG - Intergenic
926240854 2:11083962-11083984 TAAACACAGGTGTGTGGAACTGG + Intergenic
927374956 2:22402920-22402942 CACACACTGGTAGCTGGAAGGGG - Intergenic
927791032 2:26009643-26009665 GACATACAGGAGTCTCGAACTGG + Intergenic
933878890 2:86647928-86647950 GCCACCATGGTGTCTTGAACTGG + Intronic
934903463 2:98179158-98179180 GAGGCACTGGTGTCTGGAGCTGG - Intronic
935982088 2:108637551-108637573 GACACACTGGAGGCTGTCACTGG + Intronic
937217061 2:120319443-120319465 GTCACCCTGGTGTCTGGCCCTGG + Intergenic
941974373 2:171386857-171386879 GACACACAGGTGGCTGGACATGG + Intronic
944195851 2:197052125-197052147 GACCCACTGGTGTGTAGACCAGG + Intronic
945672219 2:212816256-212816278 GTCAAGTTGGTGTCTGGAACAGG - Intergenic
947472857 2:230414284-230414306 GACACACTGGGGTTGGGAAAGGG - Intergenic
947960746 2:234235057-234235079 GACACCCTGGTGACAAGAACTGG + Intergenic
948223419 2:236290924-236290946 GTGACCCTGGTGCCTGGAACAGG - Intergenic
1169478367 20:5953053-5953075 GACTCAGTGGTGCTTGGAACTGG + Intronic
1170473398 20:16690645-16690667 GAAACACTGGTGGCTGGATGTGG + Intergenic
1172053717 20:32139500-32139522 GTGACACCGGTGACTGGAACAGG - Intronic
1176254024 20:64141214-64141236 GAGACACAGCTGTGTGGAACCGG + Intergenic
1177022498 21:15880543-15880565 CACACACTGGTGTCTGGCAGAGG - Intergenic
1177130894 21:17253706-17253728 GATACACTCGTGAATGGAACAGG - Intergenic
1177406514 21:20674569-20674591 GACACACTCTTGTCTGTAAAGGG + Intergenic
1180683186 22:17643536-17643558 GACTCACTGGTGGCTTGAACAGG - Intronic
1180899177 22:19358508-19358530 GATACACAGGTGCCTGGGACTGG + Intronic
1181933975 22:26427130-26427152 GACAAACTGGGTTCTGGAACAGG + Intergenic
1182512049 22:30826687-30826709 GTCTAACTGGTGTTTGGAACCGG + Intronic
1183434377 22:37784940-37784962 GTCACTCAGGTGCCTGGAACAGG - Intergenic
1184592981 22:45497968-45497990 GACACAATGCTGGCTGGAAGTGG + Intergenic
1185368618 22:50448240-50448262 CACTCTCTGCTGTCTGGAACTGG + Exonic
1185411310 22:50684400-50684422 CACACACTCTTGTCTGTAACTGG - Intergenic
953234430 3:41093802-41093824 GACACAAGGGGCTCTGGAACTGG + Intergenic
954400689 3:50318027-50318049 GACAAACTGGAGTCTGGAGTGGG - Exonic
957011929 3:75016159-75016181 GAAACACTGGTGGCTGGACTAGG - Intergenic
957256079 3:77839603-77839625 CACACACTGGTGTCTGTCAGGGG - Intergenic
966665380 3:182465415-182465437 TCCAGACTGGTGTCTGGAATTGG + Intergenic
971985483 4:33817333-33817355 GATACACTGGTGGCTTAAACAGG - Intergenic
975926446 4:79460522-79460544 GCCACACAGGTGTTTGGTACTGG - Intergenic
976511000 4:85910052-85910074 GACACACTGGCTGCTGCAACGGG + Intronic
978570841 4:110135203-110135225 GAAACACTGGACTCTGGTACAGG - Intronic
980720106 4:136684583-136684605 GATACACTATTGTCTGGAAAGGG - Intergenic
985371494 4:189289898-189289920 GACACACACGTGCCTGGACCTGG + Intergenic
985674095 5:1221486-1221508 GACACATTGGTGTCAGGGAGGGG - Intronic
986949110 5:13060306-13060328 GACACACTGGTGCAAGGCACGGG + Intergenic
990825753 5:59895505-59895527 GTCACACTTGTGTCTGCAAAAGG - Intronic
992893402 5:81225625-81225647 TACGCACTGGTGTCTGAAAGAGG + Intronic
994850499 5:105049393-105049415 CACACACTGGGGTCTGTCACAGG - Intergenic
995946120 5:117648371-117648393 CACACACTGGTGCCTGGAGGTGG - Intergenic
1000432177 5:161165141-161165163 GATACACTGGCGTGGGGAACTGG - Intergenic
1001426258 5:171624653-171624675 AAAACACAGGTGTGTGGAACTGG + Intergenic
1002997714 6:2302837-2302859 CACACACTGGGGTCTGGCATGGG + Intergenic
1007487504 6:42191809-42191831 GACAAACTGATGTCTTGTACCGG + Intronic
1007889666 6:45275577-45275599 GACAGACTGATTCCTGGAACAGG + Intronic
1011209711 6:84941959-84941981 GACACACTGGGGTCTGTTAGGGG + Intergenic
1011355078 6:86465608-86465630 CACACACTGGGGTCTGTCACGGG + Intergenic
1015592014 6:134831385-134831407 TTCACACTGATGCCTGGAACTGG + Intergenic
1017013297 6:150079687-150079709 GGCACAGTGGGGTCTGGAGCAGG - Intergenic
1017956950 6:159186616-159186638 GACACAGGGGTCTCTGGCACAGG + Intronic
1021306103 7:19034407-19034429 CACACACTGGTGCCTGCAGCGGG - Intronic
1026148995 7:67772279-67772301 GTCACACTGGTGTCAGGCAGTGG - Intergenic
1029730263 7:102433867-102433889 GACGCCCCGGTGTCCGGAACCGG - Intronic
1031498285 7:122479111-122479133 GTCACTCTGGTGTCTGGGAGTGG + Intronic
1033777136 7:144624628-144624650 AACAAACTGGTGCCTGGCACTGG - Intronic
1034072968 7:148205269-148205291 AACACCCTGGTGTGTGCAACAGG + Intronic
1035052167 7:156005245-156005267 TCCCCACTGGTTTCTGGAACAGG + Intergenic
1039126521 8:34208952-34208974 GACACACTGGGGCCTGTAAGGGG - Intergenic
1039854207 8:41398471-41398493 GACACAAGGGTCTATGGAACTGG + Intergenic
1045717362 8:105064085-105064107 TACACACTGTTGTCTGGATGAGG - Intronic
1049246674 8:141566460-141566482 TGCACAGTGGTGACTGGAACGGG - Intergenic
1057412582 9:94830201-94830223 CACACACTGGAGTCTGTCACGGG - Intronic
1058616025 9:106828542-106828564 GACAGGCTGCTGTCTAGAACAGG - Intergenic
1060525204 9:124316543-124316565 GACACACTTGGGTCAGGGACAGG - Intronic
1060586889 9:124792257-124792279 GACACACTGGAGCCTAGATCAGG - Intronic
1187104151 X:16223016-16223038 GACACACTGGTGTAAGGGATAGG + Intergenic
1188571358 X:31588935-31588957 AACACACTGGTGGCTTAAACTGG - Intronic
1189412469 X:40785078-40785100 CACACACTGGTCTGGGGAACAGG + Intergenic
1189975918 X:46461296-46461318 GAGATACTGGTCTATGGAACAGG + Intronic
1189983150 X:46530404-46530426 GAGATACTGGTCTATGGAACAGG - Intronic
1196264132 X:113621794-113621816 GACTCACTGGTGTCTGTATAAGG + Intergenic
1196346359 X:114664379-114664401 CACACACTGGAGTCTGGAGGTGG - Intronic
1198051103 X:132954360-132954382 GAGAAGCTGGTGTCTGGAAATGG - Intronic
1199840878 X:151647048-151647070 GAGACACTGGAGTGGGGAACAGG + Intronic