ID: 901798962

View in Genome Browser
Species Human (GRCh38)
Location 1:11696215-11696237
Sequence AAGGGGAGACAGAGGGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1561
Summary {0: 1, 1: 1, 2: 14, 3: 163, 4: 1382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901798962 Original CRISPR AAGGGGAGACAGAGGGAGTA AGG (reversed) Intronic
900085827 1:895836-895858 AAGGGGGGAAACAGGGATTACGG - Intergenic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900471371 1:2856665-2856687 AAGGGGAGGCGGAGGGAGGGAGG - Intergenic
900628815 1:3623132-3623154 GGGGGGAGAAAGAGGGAGAATGG - Intergenic
900701238 1:4049781-4049803 AGGGGGAGAAAGAGGGAGGAAGG + Intergenic
900853639 1:5163327-5163349 AAGGGATGACTGAGGGAGAATGG - Intergenic
900875522 1:5340035-5340057 AAGGAGATTCAGAGGGAGCAGGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
901649341 1:10734675-10734697 AAAGAGAGAGAGAGGGAGAAGGG + Intronic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
901776208 1:11561844-11561866 AAGGAGAGAGAGAGAGAGAAAGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901862590 1:12084396-12084418 TGGTGGGGACAGAGGGAGTATGG + Intronic
902278763 1:15359174-15359196 AAGAGGAGACAAGAGGAGTAAGG + Intronic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
903093668 1:20947603-20947625 AGGGAGAGAGAAAGGGAGTAAGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
904001088 1:27339192-27339214 AAGGGGAGAAAGCCAGAGTAAGG + Intergenic
904128704 1:28260151-28260173 AGGGGGAGAGGGAGGGAGGAGGG - Intronic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905481881 1:38267627-38267649 AAGGAGAGACGGAGGGAAGAAGG - Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
905933734 1:41807436-41807458 AGAGAGAGACAGAGGGAGTGAGG + Intronic
906471408 1:46133644-46133666 AAGGGGAGAAGCAGGGAGTGGGG - Intronic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906812223 1:48839584-48839606 GAGGGGAGACAGAGAGTATAAGG + Intronic
906824968 1:48969600-48969622 GAAGGGAGAGAGAGGGAATAAGG - Intronic
906841533 1:49144720-49144742 AAAGGGAGACAGACTGAGCAGGG + Intronic
907007149 1:50926425-50926447 AAGGGCAGTGAGAGGGAGAATGG + Intronic
907093689 1:51754084-51754106 AAGGGGAGAGAAGGGGAGTAGGG + Intronic
907303641 1:53502523-53502545 AGGGGGAGGGACAGGGAGTAGGG + Intergenic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907683751 1:56589933-56589955 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
907709267 1:56863605-56863627 AAGGAGAGACAGAAGGTATAGGG - Intronic
907977392 1:59445137-59445159 AGGGAGAGAAAGAGGGAGGAGGG + Intronic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908179384 1:61589018-61589040 AGGGGGAGACAGAGAGAGAGAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908800893 1:67879630-67879652 AAAGGGAGAGAGAGGAAGGAAGG - Intergenic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909452362 1:75812329-75812351 AATGGGAGACTAAGGGAATAAGG + Intronic
909647090 1:77929864-77929886 AAGGAGGGAGAAAGGGAGTATGG - Intronic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
909925038 1:81428857-81428879 AAGGGGAGAGAGAGGGACAGTGG + Intronic
910072967 1:83242149-83242171 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910355391 1:86346871-86346893 AAATGGATACAGAGGTAGTATGG + Exonic
910417598 1:87017124-87017146 AAGGAGAGAGAGAGAGAGAAAGG - Intronic
910547955 1:88440609-88440631 AGGGGGAGAGAGAGAGAGGAAGG + Intergenic
910634800 1:89395189-89395211 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
910735040 1:90444360-90444382 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
910808303 1:91210776-91210798 AAGGAGAGAGAGAGGGAGAGAGG - Intergenic
911033014 1:93509840-93509862 AAGGGGAGACAGACGGCATCTGG + Intronic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911992127 1:104712153-104712175 AGGGGAAGACAGAGGAAGAAGGG - Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912520836 1:110243621-110243643 AAGAGGAGGAAGAGGGAGAAGGG + Intronic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912876385 1:113364218-113364240 AAGGGGAGAAAGATGGAACAAGG + Intergenic
912974972 1:114321317-114321339 GTGGGGAGGCAGAGAGAGTAGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
914230701 1:145763003-145763025 AAAGGGAGAGGGAGGGAGAAGGG + Intronic
914830581 1:151168153-151168175 AAAGGGAGACAGAGGGACCAGGG - Exonic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
915180179 1:154052015-154052037 AAGGGGAGAAACAGGGACTACGG + Intronic
915300451 1:154948410-154948432 ATGGGGAGACACAGGGAGAGAGG + Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915750847 1:158208948-158208970 AAGGAGATAGAGAGGGAGTTTGG - Intergenic
915900736 1:159844969-159844991 AAGGTGAGAGAGAGGAAGCAGGG + Intronic
916212152 1:162367827-162367849 ACGGGGAGAGTGAGGGGGTAGGG - Exonic
916335437 1:163665659-163665681 AAGTGGACTCTGAGGGAGTAAGG + Intergenic
916530203 1:165649379-165649401 AGAGGGAGAGAGAGGGAGTGGGG - Intronic
916886951 1:169078710-169078732 AAGGAGAGACAGAGGGAACTAGG + Intergenic
917080178 1:171249718-171249740 AGAGAGAGACAGAGGGAGTAGGG + Intronic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
917539566 1:175899694-175899716 TAAAGGAGACAGAGGGAGGATGG + Intergenic
918009030 1:180569373-180569395 AAGAGGAGACAGCGTGACTATGG + Intergenic
918184917 1:182118585-182118607 AGGAGGAGACAGAGAGAGAAAGG + Intergenic
918234810 1:182570340-182570362 AAGGGAAGACAGAGGGGTCAGGG - Intergenic
918576193 1:186063390-186063412 AAGGGAAGAAAGAGGGAGTGGGG + Intronic
918706136 1:187664896-187664918 AAAGGGAGAAAAAGGGAGAAAGG - Intergenic
918707283 1:187681126-187681148 GTGGGGAGAAAGAGAGAGTAGGG - Intergenic
918716688 1:187797775-187797797 AAGGAGAGAGAGAGAGAGAAAGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
918818639 1:189225001-189225023 AGAGGGAGAGAGAGGGAGAAAGG - Intergenic
919053819 1:192543853-192543875 AAAGGGAAAATGAGGGAGTAGGG - Intergenic
919739647 1:200974067-200974089 AAGAGGAGACAGGGAGAGTTGGG + Exonic
919798606 1:201337067-201337089 ATGGGGAGACAGAGGCAGCCCGG + Intergenic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919867090 1:201790513-201790535 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
919920485 1:202164004-202164026 CAGGGGAGACAGGGTGAGTGGGG + Intergenic
920032223 1:203044345-203044367 AAGGGGAGATGGAGGAAGAAAGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920301387 1:204991248-204991270 ATGGCCAGACAGAGGGAGAAAGG - Intronic
920303854 1:205006436-205006458 AAGGGGAGATTCAGGGAGGAGGG + Intronic
920428019 1:205894229-205894251 AGGGGGAGAAAGAGGGATTATGG + Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
920965191 1:210695534-210695556 AAGGAGGGACAATGGGAGTAGGG - Intronic
921771918 1:219050528-219050550 AGGGGGAGATGGAGGGAGGAAGG + Intergenic
921833995 1:219759366-219759388 AGGGAGAGAGAGAGGGAGGAGGG + Intronic
921838120 1:219799134-219799156 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
922775876 1:228213983-228214005 AAGGGGAGACGGAGTGGGCAGGG + Intronic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923425511 1:233864954-233864976 AAGGGAAGAGACAGGGAGTGGGG + Intergenic
923510016 1:234642804-234642826 AAGGGGAGACAAAGGGAGTGGGG + Intergenic
923569584 1:235101642-235101664 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
924158583 1:241206915-241206937 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
924653781 1:245954317-245954339 AAGATGAGCCAGAGGCAGTAAGG + Intronic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1062880040 10:970798-970820 AAGCAGAGCCAGAGGGATTAGGG + Intergenic
1063044100 10:2373887-2373909 AAGGAGAGACAGAGGCTGGAAGG - Intergenic
1063484255 10:6404494-6404516 AAGGAGAGACAGAGAAAGAAAGG - Intergenic
1063511250 10:6647066-6647088 AGGGGGAGAGAGAGGGAGAGAGG - Intergenic
1063525282 10:6778981-6779003 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1063691884 10:8295568-8295590 AAGGGGAGAGAGAGGAAGGAAGG - Intergenic
1063691897 10:8295614-8295636 AAAGGGAGAGAGAGGAAGAAAGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1064050663 10:12056743-12056765 AAGGGGAGAGAGAGAGAGACTGG - Intergenic
1064232801 10:13544278-13544300 AGGGGTAGAGAGAGGGATTACGG + Intergenic
1064333260 10:14414422-14414444 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1064355826 10:14616939-14616961 AAAGAGAGAGAGAGAGAGTAAGG + Intronic
1064364689 10:14697055-14697077 ATGGGGAGGCACAGGGAGAAAGG + Intronic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1064559184 10:16578871-16578893 TAGGGGTGAGAGAGGGAGTAGGG + Intergenic
1065486076 10:26237529-26237551 GAGACGAGACAGAGGGAGCAGGG + Intronic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065550114 10:26861223-26861245 AAGCGGAGACCGAGGGTGGAGGG + Intergenic
1065618498 10:27553773-27553795 AGGGGGAGAAAGAGAGATTATGG - Intergenic
1065634400 10:27715833-27715855 AAGGGCAGACAGAGGACCTATGG + Intronic
1065638278 10:27753155-27753177 AAGGGGGGAGAGAGGAAGGAAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1066206460 10:33193934-33193956 AAGGGTAGACAGAGCCAGTTTGG + Intronic
1066592986 10:37016117-37016139 AAGTGAAGACAGAGAGAGAAAGG - Intergenic
1066728907 10:38419098-38419120 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1067118359 10:43453007-43453029 AAAGGGGGAATGAGGGAGTATGG + Intronic
1067249168 10:44572711-44572733 AAAGGGAGAAAGAGAGAGAAGGG - Intergenic
1067314128 10:45145280-45145302 AGAAGGAGACAGAGGGAGAAGGG + Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067530681 10:47069395-47069417 AAGGAGAGGCAGAGGGAGACAGG - Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068519710 10:58064801-58064823 AAGAGGAGACAGAGAGAAAAGGG - Intergenic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1068792561 10:61043218-61043240 AAAGGGAGAATGAGGGAGTAGGG + Intergenic
1068803870 10:61172757-61172779 AAGGAGGGACGGAGGGAGGATGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1068894170 10:62181305-62181327 AAGGGAATACAGAGTGAGTTTGG + Intergenic
1068924076 10:62516756-62516778 AAGGGGAGGAAGAGGAAGCAGGG - Intronic
1069063880 10:63922495-63922517 AAGGAGAGAGAGAGGGAGACAGG + Intergenic
1069473790 10:68715611-68715633 AGGGAGAGAGGGAGGGAGTAGGG - Intergenic
1069655089 10:70081700-70081722 ACTGGGAGACAGAGGGGGTGGGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1069853050 10:71422984-71423006 AAGGGGAGAGAGAGGGAAAGAGG - Intronic
1070383755 10:75904981-75905003 GAGGGGAGAGAGGGGGAGAAAGG + Intronic
1070569949 10:77633333-77633355 AAGGAGAGAGAGAGAGAGCAAGG + Intronic
1070637091 10:78137705-78137727 AAGAGGAGAAAGAGGAAGGAAGG - Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1070967127 10:80536482-80536504 AAGAGGAGACAAGGGGAGGAAGG - Intergenic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1071883333 10:89923132-89923154 AAGAGGAGAGAGAGCGAGCAAGG - Intergenic
1072039237 10:91591443-91591465 AGGGGGAGACAGAGAGGGTAGGG - Intergenic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1073038176 10:100578817-100578839 GAGGGGAGACAGAGAGAAAAGGG + Intergenic
1073077562 10:100834014-100834036 AAGGAGAGACAGTGGGTGCAGGG + Intergenic
1073086732 10:100895874-100895896 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073277377 10:102324158-102324180 AAGGGGAGAGAGAGGAAGGGAGG - Intronic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1073496475 10:103896089-103896111 AAAGGGAGTGAGAGGGAGGATGG + Intronic
1074278660 10:112029336-112029358 AAAGGGAGAATGAGAGAGTAGGG + Intergenic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074731820 10:116386477-116386499 AAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1074827996 10:117228491-117228513 AAGGGGAGAAGGAGGGAGGGAGG - Intergenic
1074828014 10:117228543-117228565 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1074828022 10:117228571-117228593 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1075010729 10:118867591-118867613 AAGGAGAGAAGGAGGGAGAAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075427983 10:122356821-122356843 AAGGGGGCACAGAGAGATTAAGG + Intergenic
1075639319 10:124053378-124053400 AGGGGGAGACAGGTGGAGCAGGG + Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075983123 10:126758455-126758477 AAAGGGAGAATGAGGGAGTGGGG - Intergenic
1076252414 10:128994952-128994974 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1076732051 10:132444060-132444082 AAGGGGAGAGGGAGTGAGTGGGG - Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076776623 10:132701468-132701490 AAATGGAGGCAGAGGGTGTATGG - Intronic
1076943168 10:133623356-133623378 AGGGAAAGACAGAGGGAGAAAGG - Intergenic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078310976 11:10241887-10241909 AATGGGAGAAAGAAAGAGTAAGG + Intronic
1078436956 11:11333199-11333221 AAGGTGAGAGAGAGGGGGGAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078807953 11:14725504-14725526 AAGGGGAGAAGGAGGGGGAAGGG - Intronic
1079251780 11:18792200-18792222 ACAGGCAGACAGAAGGAGTAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080097339 11:28424817-28424839 AAAGGGACACAGAGGAAGTCTGG - Intergenic
1080283396 11:30584460-30584482 AACGGGGGACTGAGCGAGTAAGG - Intronic
1080352046 11:31396533-31396555 AAGGGGAAACATAGGAAGCAGGG - Intronic
1080352488 11:31401448-31401470 AAGAGGAGACAGCGGGAGAAGGG - Intronic
1080501491 11:32875450-32875472 AAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1081000929 11:37669928-37669950 AAAGAGAGACAGAGAGAGAATGG - Intergenic
1081117409 11:39220896-39220918 AAAGAGAGAGAGAGGGAGTGGGG + Intergenic
1081578586 11:44335214-44335236 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1081896063 11:46587657-46587679 AAGGGCTGACAGAGGGAAGAAGG - Intronic
1082099710 11:48162392-48162414 AAAGGGAGGGAGAGGGAGGAGGG - Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082729086 11:56773125-56773147 AAGGGGAGATGGAGGCAGCATGG - Intergenic
1083441002 11:62676556-62676578 AAGGGGTCACAGAGGGACAATGG + Exonic
1083487385 11:62992151-62992173 AAGGGGAGAAAGAGCCAGTGTGG + Intronic
1084347629 11:68565928-68565950 GATGGGAGCCAGAGGGAGTGAGG + Intronic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084650090 11:70484403-70484425 AGGGGGAGCAAGAGGGAGTCGGG - Intronic
1085925261 11:81010939-81010961 AAGGGAAGAAAGGGGAAGTAAGG + Intergenic
1086114239 11:83230387-83230409 TAGGGGAGTCAGAGGGAGGTAGG - Intronic
1086473431 11:87142709-87142731 AAGGGGTGAAGGAGGGAGAAGGG - Intronic
1086598199 11:88600295-88600317 AAGGGGAGGGAGAGGGGGAAGGG - Intronic
1087144534 11:94798925-94798947 AAGGGGAGACAGCAAGTGTAGGG + Intronic
1087165067 11:94994813-94994835 GAGGAGGGAGAGAGGGAGTAAGG + Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1088171153 11:106998276-106998298 AAGGAGAGAGAGAGGGTGAAAGG + Intronic
1088343992 11:108801989-108802011 AAGGGGAGAGAAAGTGAGTGGGG + Intronic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088613134 11:111598454-111598476 AAGAGGAGAAAGAGGGAGAGAGG + Intergenic
1088645476 11:111913320-111913342 GAGGGGAGTCAGGAGGAGTAGGG - Intronic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089494205 11:118900207-118900229 ACGGGGAGACAAAGAGAGCAGGG + Intronic
1089705161 11:120272443-120272465 AATGGGAGGTAGAAGGAGTAGGG + Intronic
1089954864 11:122560855-122560877 AAAGGGGGAGGGAGGGAGTAAGG - Intergenic
1090172467 11:124616975-124616997 AAGGAGAGAGAGAGAGAATAAGG - Intronic
1090206604 11:124887682-124887704 AAGGGGTGAGATAGGGTGTAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090833720 11:130438630-130438652 AAAGAGAGAGAGAGGGAGAAAGG - Intergenic
1090934881 11:131332675-131332697 AATGGCAGACACAGGGAGCAGGG + Intergenic
1090973277 11:131660671-131660693 AAGCGGGGACAGAGGGTGTGGGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091168118 11:133498379-133498401 AAGAGGAGACAGAGAGACTGAGG + Intronic
1091755914 12:3051454-3051476 AGGGGGAGAGAGAGAGAGAAAGG - Intergenic
1091813643 12:3419958-3419980 AGGGGGAGAAAGAGGGAGAGGGG + Intronic
1092067573 12:5604591-5604613 AAGGGAAGACACAGGGGCTACGG + Intronic
1092228429 12:6764108-6764130 AAGGGGAGGCGGAGGGAGCCGGG - Intronic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092359809 12:7827023-7827045 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1092445417 12:8551509-8551531 AAGGGGAGTGAGACAGAGTAAGG + Intergenic
1092789044 12:12056070-12056092 AAGGGGAAACATTGGGAGTCAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093251750 12:16813856-16813878 AAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1093253197 12:16833573-16833595 AAGGGGACACAACGGAAGTAGGG + Intergenic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093348320 12:18067781-18067803 AAGGGGAGAGAGAGGAGGTGGGG - Intergenic
1093385743 12:18551164-18551186 AAGGGGAGTGAAAGAGAGTAAGG - Intronic
1093509651 12:19911379-19911401 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1093625223 12:21338451-21338473 AAGAGGAAACATCGGGAGTAAGG - Intronic
1093838608 12:23868068-23868090 AAGGAGGGAGAGAGGGAGTGAGG - Intronic
1094063498 12:26340087-26340109 GAGGGGAGACAGAGGGTCCAGGG - Intronic
1094122294 12:26987096-26987118 AAGGGGAGGCAGAGGTGGAAGGG - Intronic
1094615120 12:32029466-32029488 AAGGAAAGAAAGAGGGAGAAAGG + Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094728521 12:33147659-33147681 AAGGGGTGACAGAGGGCATCTGG - Intergenic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096416140 12:51415761-51415783 AAGGGGAGAGAGTGGGAGGGAGG + Intronic
1096693665 12:53335726-53335748 AAAGGGAGAGGGAGGGAGAATGG + Intronic
1096786999 12:54022675-54022697 AGGGGGAGAAAGAGGGGGAAAGG + Intronic
1096808875 12:54157281-54157303 AAAGGGAGACAGAAGGGGTGGGG - Intergenic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097283934 12:57863401-57863423 AAGGGGAGACAGAGGCAGCTGGG - Intergenic
1097344635 12:58477295-58477317 AAGGGGTGACAGAGGGCATCTGG - Intergenic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098371134 12:69760987-69761009 AAGGAGAGAGAGAGGAAGAATGG - Intronic
1098428603 12:70394102-70394124 AGAGGGAGAGAGAGGGAGAAGGG + Intronic
1098460812 12:70731119-70731141 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1098816013 12:75163140-75163162 AAGGGGAGAGAGAGGGAGATTGG + Intronic
1099359580 12:81683592-81683614 AAGGCAGGACAGAGGGAGAACGG - Intronic
1099464489 12:82966361-82966383 AAGGGGAGAGAGGGGCAATAAGG - Intronic
1099747211 12:86720570-86720592 AAAAGGAGATATAGGGAGTAAGG - Intronic
1099914471 12:88874844-88874866 CAGGGGAGACAGAGCGTGTGGGG + Intergenic
1100103428 12:91138639-91138661 AATGGGAGACAGAGGGAGTAAGG + Intergenic
1100375569 12:94013209-94013231 AGGGAGGGAGAGAGGGAGTAAGG + Intergenic
1100549200 12:95631043-95631065 GAGAAGAGAGAGAGGGAGTAGGG + Intergenic
1100782764 12:98046997-98047019 AAGGGGAGAGAGATGGAGAGAGG + Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101215846 12:102581667-102581689 AAGGCGAGAGAGTGGGAGGAGGG - Intergenic
1101255528 12:102973488-102973510 AAGGGGGGAGGGAGGGAGAAAGG - Intergenic
1102076241 12:110062415-110062437 ATGGGGAGAGAGTGGGAGTGGGG + Intronic
1102349770 12:112183965-112183987 AAGGGGAGCCAGAGGGCTCAGGG - Intronic
1102429009 12:112867207-112867229 AAGGGGAGAAAAAAGCAGTAAGG - Intronic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102547941 12:113670184-113670206 AAAGGAAGAAAGAGGGAGTGAGG + Intergenic
1102615770 12:114152750-114152772 AAGGGAAGACAGAAGGGCTAGGG + Intergenic
1102682253 12:114698708-114698730 AAAGGGAGAGAGAGGGAGATAGG - Intergenic
1102717409 12:114986294-114986316 AGGGAGAGAGAGAGGGAGAAAGG - Intergenic
1102907196 12:116685908-116685930 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1102992148 12:117322849-117322871 AAGGAGGGAGGGAGGGAGTAAGG - Intronic
1102994958 12:117342121-117342143 AAGGAGAGAAAGAGGGAGGGAGG - Intronic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103289485 12:119833049-119833071 AAGGAGAGAGAGAGGGAGAGAGG + Intronic
1103540350 12:121661886-121661908 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1104232505 12:126898716-126898738 AAGGGGAGAGAGAGGGAGAGAGG + Intergenic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104753349 12:131253812-131253834 CAGGAGAGAGAGAGCGAGTAGGG - Intergenic
1105372643 13:19815161-19815183 AAAGGGAGAATGAGGGAGTAAGG + Intergenic
1105561310 13:21494271-21494293 AAGGAGAGAGAGAGAGAATATGG - Intronic
1105709210 13:22989991-22990013 AAAGAGAGAGAGAGAGAGTAGGG - Intergenic
1105887713 13:24656452-24656474 GAGGGGAGAGAGAGGAAGGAGGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106353452 13:28956685-28956707 AAAGGGAGATAGAGGGAGTGAGG + Intronic
1106940629 13:34775028-34775050 ATGGGGAAAGAGAGAGAGTAAGG + Intergenic
1107186396 13:37526874-37526896 AAAGGGAGAAAGAGAGAGAAAGG - Intergenic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107679159 13:42830123-42830145 AAGGGGAAACTGAGGCATTACGG - Intergenic
1107904519 13:45049965-45049987 AAGGGGTAACTGAGGGAGCAAGG - Intergenic
1108079974 13:46725202-46725224 AAGGGGAGAGATAGGGGGTGAGG + Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1108546386 13:51499475-51499497 ATGGGGAGAGAGAGGGGGTGAGG + Intergenic
1108561017 13:51644102-51644124 GGGGAGAGACAGAGGGAGTCAGG + Intronic
1108907138 13:55490553-55490575 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1110753076 13:79138210-79138232 AAGGGGAGACAGAGAAGTTAAGG + Intergenic
1110939751 13:81334834-81334856 AGGGGGAGAGAGAGAGAGGAAGG - Intergenic
1111180319 13:84654936-84654958 ATGGGGAGAGACAGGGGGTAGGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111752734 13:92355545-92355567 AAGGGGAAAAACAGGGAGCATGG - Intronic
1112184313 13:97113420-97113442 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113011825 13:105776313-105776335 AATGGGATGCTGAGGGAGTATGG - Intergenic
1113014579 13:105814108-105814130 AAAGAGAGACAGAGTGACTAAGG - Intergenic
1113066321 13:106376821-106376843 CAAGGGAGACAGATGGATTAGGG - Intergenic
1113257323 13:108521000-108521022 AAGGAGGGAAAGAGGGAGAAAGG - Intergenic
1114350104 14:21841036-21841058 AAGGAGAGAAAGAGAGAGAATGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114702544 14:24693722-24693744 GAGGGGAGCCAGAGGCAGCAGGG - Intergenic
1114814923 14:25945769-25945791 AAGGAGAGACAGTGGAAGAAGGG + Intergenic
1114822452 14:26037816-26037838 AATGGGAGTCAGTGGGAGTATGG - Intergenic
1114898039 14:27017469-27017491 AAGAGCAGACAGAGGCAATATGG - Intergenic
1115211749 14:30973351-30973373 AAGGGGACAGAGAGGGAGAGGGG + Intronic
1116038258 14:39655514-39655536 AAGAGGAGACAGAGTGTGCAAGG + Intergenic
1116324048 14:43508818-43508840 AAGGAGAGACAGAGAGAGACAGG + Intergenic
1116358956 14:43968685-43968707 AAGGGGAGGGAGAGGCAGTGAGG - Intergenic
1116731508 14:48628388-48628410 GAGGGGAGAGAGGGGGAGAAGGG - Intergenic
1117244804 14:53874247-53874269 TAAGGGAGAGAGAGGGAGAAAGG + Intergenic
1117251133 14:53939834-53939856 AAAGGGATAGAGATGGAGTAGGG - Intergenic
1117356492 14:54928722-54928744 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118073409 14:62271171-62271193 AAGGAGAGAGGGTGGGAGTAAGG - Intergenic
1118236838 14:64013471-64013493 AAGGTGAGACAGTGGGAGTGGGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118597688 14:67448780-67448802 GACTGGAAACAGAGGGAGTAGGG + Intronic
1118617187 14:67582092-67582114 AAGGGGAGACGGACCGAGAACGG + Exonic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119184764 14:72632578-72632600 AAGGAGAGAGAGAGGAAGGAGGG + Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1120011391 14:79419602-79419624 GAGGGGAGAGAGAGAGAGAAAGG + Intronic
1120049218 14:79845711-79845733 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049223 14:79845729-79845751 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049228 14:79845747-79845769 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049233 14:79845765-79845787 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049238 14:79845783-79845805 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049243 14:79845801-79845823 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049248 14:79845819-79845841 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120049253 14:79845837-79845859 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120802080 14:88701543-88701565 AAGGAGAGAAAGAGCAAGTAAGG + Intronic
1120806560 14:88757827-88757849 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1120841089 14:89085400-89085422 TGGGGGAGAGAGAGGGAGAAAGG - Intergenic
1120899917 14:89566891-89566913 GAGGGGAGAAGGAGGGGGTAGGG - Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121216384 14:92251582-92251604 AAGGAGAGCCAGAGAGAGAAGGG - Intergenic
1121736231 14:96220100-96220122 CAGAGGAGACAGAGGTAGTGGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1121956489 14:98218171-98218193 AAGGGGAGAAAGAGGGAAACAGG - Intergenic
1121962071 14:98270121-98270143 AAAGGGAGAGAGAGGGAGGGAGG - Intergenic
1122448021 14:101782541-101782563 AAGGGGAGAAAGAGAGAGGGAGG - Intronic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122833986 14:104422058-104422080 AGGGAGAGGGAGAGGGAGTAGGG - Intergenic
1202843511 14_GL000009v2_random:145855-145877 AGGGGGAGAAACAGGGATTACGG - Intergenic
1202912910 14_GL000194v1_random:136090-136112 AGGGGGAGAAACAGGGATTACGG - Intergenic
1202879733 14_KI270722v1_random:46587-46609 AAGGGGAGAAACAGGGATTATGG + Intergenic
1123389277 15:19853241-19853263 AAAGAGAGAGAGAGAGAGTATGG + Intergenic
1123490607 15:20777377-20777399 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123547109 15:21346464-21346486 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1124206117 15:27722550-27722572 AAGGTGATAGAGAGGGAGTGGGG - Intergenic
1124501621 15:30232477-30232499 AAGGAAAGAAAGAGGGAGAAAGG - Intergenic
1124741944 15:32306186-32306208 AAGGAAAGAAAGAGGGAGAAAGG + Intergenic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1125371899 15:38986484-38986506 AAGGGGAGACAGATGTGGTAAGG + Intergenic
1125747045 15:42004367-42004389 AAAGGGAGAAAAAGGGAGGAAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126117496 15:45221899-45221921 AAGGGCTGACTGAGGGAATAGGG - Intergenic
1126261754 15:46701413-46701435 GAGGAGAGACAGAGCGAGAAGGG - Intergenic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126413575 15:48395912-48395934 AAGGGAAGAGAGAGGGTGTGGGG + Intergenic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127545424 15:59990208-59990230 GAAGGGAGAGAGAGGAAGTATGG + Intergenic
1127605380 15:60582287-60582309 AAGGGTAGAGACAGGGAATAAGG + Intronic
1128078012 15:64840620-64840642 AAGGAGAGAGAGAGGAAGGAGGG - Intergenic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1128926713 15:71662934-71662956 AAGGGAAGGCAGAGGGAAAATGG + Intronic
1129012781 15:72438158-72438180 AAGAGGAGAGAGAGAGAGTTGGG - Intergenic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1129905653 15:79185468-79185490 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1129990101 15:79954712-79954734 AAGGTGAAAAAGAGGGAGTATGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130329216 15:82907534-82907556 AAAGGGAGAGAAAGGGAGAAAGG + Intronic
1131010843 15:89017360-89017382 AAGGGGAGGCAAAGAGAGGAAGG - Intergenic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131768879 15:95712843-95712865 AAGGGGAGAGAGAGGGCACAGGG - Intergenic
1131785409 15:95906591-95906613 AAGGGGAGGGTGAGGGAGGAGGG + Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132226997 15:100150571-100150593 GAGGAGGGACAGAGGGAGGAAGG - Intronic
1132307016 15:100823143-100823165 AAGGGAGGAGAAAGGGAGTAGGG - Intergenic
1132397108 15:101482164-101482186 AAGGTGAGTCAGAGGGTGTGGGG + Intronic
1202955439 15_KI270727v1_random:73680-73702 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133044373 16:3078739-3078761 AGGGGGAGAGATAGGGATTATGG - Intronic
1133089119 16:3389914-3389936 GGAGGGAGACAGAGGGAGTGGGG - Intronic
1133342714 16:5047137-5047159 AGGGGGAGACAGAGAGAGGAAGG - Intronic
1133513484 16:6483583-6483605 AAGGAGAGAAAGAGGGAGAGAGG + Intronic
1133589546 16:7229541-7229563 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1133589558 16:7229580-7229602 AAAGGGAGAGAGAGGAAGGAAGG + Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133649818 16:7801750-7801772 AAGGGGAAACTGTGGGAGTCTGG + Intergenic
1133690981 16:8214798-8214820 AAGGAGAGACAAAAGGAGTAAGG + Intergenic
1133720364 16:8488966-8488988 GGGGGGAGGCAGAGGGAGGAAGG + Intergenic
1133758649 16:8781035-8781057 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1133820528 16:9232287-9232309 AAAGGGAGGGAGAGGGAGGAGGG - Intergenic
1134259679 16:12640929-12640951 AAGGGGAGGGAGAGAGAGTGTGG - Intergenic
1134617544 16:15663145-15663167 TAGGGGAGCTAGAGGGAGTCTGG - Intronic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134770544 16:16805518-16805540 AAGGGAAGACAGAATGATTATGG + Intergenic
1134853795 16:17503103-17503125 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135590545 16:23702118-23702140 GAGGGGAGAGAGTGGGGGTAGGG - Intronic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135660535 16:24292601-24292623 AAGGGGAGAGGGAGAGAGTCTGG - Intronic
1135754362 16:25083999-25084021 AAAGTGAGACAGAGGGTGTAGGG + Intergenic
1135798207 16:25466482-25466504 AACTGGAGAGAAAGGGAGTAGGG - Intergenic
1135920390 16:26644087-26644109 AAAGGGAGAAGGAGGGAGGAAGG - Intergenic
1136911880 16:34150493-34150515 AAGGAGAGAAAGAGGGAGAGAGG + Intergenic
1136920519 16:34267532-34267554 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
1137413031 16:48245180-48245202 AAAGGGAAACAGAAGGATTAGGG - Intronic
1137425787 16:48379445-48379467 AAGGGGAAACACAGGCAATAAGG + Intronic
1137754130 16:50887991-50888013 AAGTGGAGAGGGTGGGAGTAGGG - Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138083536 16:54114228-54114250 ACGGAGAAAAAGAGGGAGTATGG - Exonic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138376337 16:56566555-56566577 AAGGAGAGAGAAAGGGAGAAAGG + Intronic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139216015 16:65124076-65124098 AAAGGCAGACAGAGGAAGCAGGG - Intronic
1139274655 16:65716354-65716376 AAGGGGAGGGAGAGGAAGGAAGG + Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139548569 16:67661135-67661157 AAGGGGAGAAAGAGGGAATTGGG - Intronic
1139846387 16:69924644-69924666 AAGGGGAGACAGGGGAAAGAAGG - Intronic
1140118597 16:72064356-72064378 TAGGGGAAACACAGAGAGTAAGG - Intronic
1140315660 16:73894317-73894339 ATGGGGAGAGAGAGGGAGAGAGG + Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1140714366 16:77708575-77708597 AAGAGGAGACATAGAGAATAGGG + Intergenic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141177152 16:81728554-81728576 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1141636196 16:85315194-85315216 AAGGGGTGGCTGAGGGAGCAGGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141812337 16:86383785-86383807 AAGGAGGGACAGAGGGAGAAAGG + Intergenic
1142652001 17:1359896-1359918 ACGGGGAGAGAGAGGGAGACGGG + Intronic
1142759460 17:2034614-2034636 GAGGGGAGAGAGGGGGAGCAGGG - Intronic
1143071202 17:4294993-4295015 AAGGAGAGACGGAGGGAGGGAGG + Intronic
1143116327 17:4583867-4583889 AAGGGCAGACAGAGAAAGAAGGG - Intergenic
1143373173 17:6453059-6453081 AAAGGAAGACAGAGAGAGGAAGG - Exonic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143881981 17:10036767-10036789 AAGGGGAAAAAGAGGGAGAGTGG - Intronic
1143924056 17:10353906-10353928 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144395912 17:14843070-14843092 TAGGGGAGAGAGAGGGAGACAGG + Intergenic
1144423375 17:15118143-15118165 AAGAGAAGGCAGAGGAAGTAGGG - Intergenic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145372038 17:22314690-22314712 AGGGGGAGACAGAGAAACTAAGG + Intergenic
1145835674 17:27952597-27952619 AAGGGGAGACTGACAGGGTAAGG + Intergenic
1146297166 17:31659198-31659220 AGGGGGAGGGAGAGGGAGAAAGG + Intergenic
1146455944 17:33009720-33009742 AGGGGGAGACAGAGGGTCTCTGG - Intergenic
1146505269 17:33399432-33399454 AGAGGGAGACAGAGGGGGAAGGG - Intronic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146905184 17:36613520-36613542 AAGGGGAGGCAGAGGGGTTCTGG - Intergenic
1146963075 17:37001334-37001356 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1147045904 17:37751933-37751955 AGGGAGAGAGAGAGGGAGAAAGG + Intergenic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147122573 17:38344175-38344197 AAGGGCAGGCAGAGGGAGGGAGG - Intergenic
1147383902 17:40070887-40070909 GAGGGGAGACAAAGAGAGAAAGG - Intronic
1147516483 17:41122640-41122662 AAGGGGGGAGAGAGGGAGAGAGG + Intergenic
1147658012 17:42101950-42101972 GAGGTGAGACAGAGAGGGTAGGG + Intronic
1147747239 17:42702334-42702356 GAGGGGAGACAGAGGCAGCTAGG - Exonic
1147770351 17:42863765-42863787 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1148639180 17:49172544-49172566 AAGGGGAGAAGCAGGGACTACGG - Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148774799 17:50089285-50089307 AAGGGGACACTGGGGGAGGAGGG - Exonic
1149075505 17:52593097-52593119 AAGGAGAGACAGAGAGACCAGGG - Intergenic
1149148546 17:53530657-53530679 AAGGAGGGAGAGAGGGAGAAAGG + Intergenic
1149416915 17:56469245-56469267 GAGGGGAGAGAGAAGAAGTAGGG - Intronic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150078309 17:62213262-62213284 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1150477868 17:65488166-65488188 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150477915 17:65488386-65488408 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150637999 17:66929756-66929778 AAGAGGAGAGAGAGGAAGGAGGG + Intergenic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1150989251 17:70236851-70236873 AAGTAGAAACAGAGGAAGTAGGG + Intergenic
1151016191 17:70555880-70555902 AAGGAGGGAGAGAGGGAGAAAGG + Intergenic
1151268821 17:72977634-72977656 AAGAGCAGAGAGAGGGACTAGGG + Intronic
1151371730 17:73651075-73651097 AAGGTAAGAAAGGGGGAGTAGGG - Intergenic
1151426321 17:74033107-74033129 ATGGGGAGAGAGAGGAAGTCAGG + Intergenic
1151429832 17:74055007-74055029 AAAGGGAGAGAGAGGGAGAAAGG - Intergenic
1151518100 17:74609945-74609967 TAGGGGAAAAAAAGGGAGTAAGG + Exonic
1151700785 17:75741436-75741458 ATGGGGAGAGAGAGGGAGTGAGG + Intronic
1151762322 17:76112290-76112312 GGAGGGAGACAGAGGGAGGAAGG + Intronic
1152139571 17:78528575-78528597 AAGGGGAGAGGGCGGGAGGAGGG + Intronic
1152291460 17:79442300-79442322 AGAGGGAGAGAGAGGGAGTGAGG + Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152583611 17:81179649-81179671 AAGGGGTGATAGAGGCAGTGGGG - Intergenic
1152811827 17:82386042-82386064 AGGGGAAGACGGAGGGAGGATGG - Intergenic
1153764838 18:8365629-8365651 AAGAGGAGAGAGAGGGAGAGAGG - Intronic
1153934540 18:9909557-9909579 AGGGGGAGTAAGAGGGAATATGG - Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1155008166 18:21748406-21748428 AAGGGGGGAAAGAGGGAGAGAGG - Intronic
1155219228 18:23669403-23669425 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1155308015 18:24498237-24498259 AAGGTGAGGCAGAGGGAATGGGG + Intergenic
1155371281 18:25103741-25103763 ATGGGAAGAGAGAAGGAGTAAGG + Intronic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155524492 18:26702710-26702732 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1155655196 18:28184435-28184457 AAAGGGAAAGAGAGGGAGAAAGG - Intergenic
1157220307 18:45824805-45824827 AAGAGGAGGCAGAGAGAGTATGG + Intergenic
1157377535 18:47180099-47180121 AAAGGGAGAATGAAGGAGTAGGG - Intergenic
1157575037 18:48738055-48738077 TGGGGAAGACAGAGGGAGTGGGG - Intronic
1157665891 18:49486786-49486808 TAGTGGAGACAGAGGGAGCGGGG + Intronic
1157681465 18:49610672-49610694 AAGGGGAGACAGGGGGCGTAGGG + Intergenic
1158576844 18:58645424-58645446 TAAGGGAGACAAAGGGAGAATGG + Intergenic
1158678704 18:59547080-59547102 AAAGGGAGAGAGAGGGAGGTAGG + Intronic
1158717332 18:59892339-59892361 AAGGAGAGAGAAAGGAAGTAAGG + Intergenic
1158749582 18:60243459-60243481 AAGGCCAGACAGAGAGAGTGAGG - Intergenic
1158851129 18:61496295-61496317 AGGGGGAGAGAAAGGGAGGAGGG - Intronic
1159451197 18:68604329-68604351 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
1159664432 18:71140809-71140831 AAGGGGAGAGAGAGAGAGGAAGG + Intergenic
1159923523 18:74247107-74247129 ATGGGGAGACAATGGGAGGATGG - Intergenic
1160129583 18:76212878-76212900 AGGGAGAGAAAGAGGGAGAAGGG - Intergenic
1160178624 18:76615804-76615826 ATGGGGAGGCAGAGGGACCAAGG + Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1160835944 19:1124482-1124504 AAGAGGAGACAGAGGCAGTGGGG + Intronic
1161023826 19:2025515-2025537 AAGGAGAGAGAGAGGAAGGAGGG - Intronic
1161137139 19:2626479-2626501 AAGGTGAGAGGGAGGGAGTGAGG - Intronic
1161256042 19:3310237-3310259 AGGGGGAGAGAGAGGGAGGGAGG - Intergenic
1161500277 19:4610531-4610553 AAGGGGAGACAGAGGAGGTGAGG + Intergenic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1162566428 19:11447636-11447658 AAGTGGAGACAGAGAGGGTGGGG + Intronic
1162861009 19:13505870-13505892 GAGGGGAGGCGGAGGGAGGAGGG + Intronic
1162937996 19:13991284-13991306 AAGGTGGGGCAGAGGGAGAATGG + Intronic
1163207420 19:15813828-15813850 AAGTGGAGAGAGAGGGAGGTGGG + Intergenic
1163216788 19:15885080-15885102 AAGGAGAGAGAGAGAGAGCAGGG - Intronic
1163283474 19:16331522-16331544 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1163491845 19:17621288-17621310 AAGGGCTGGCAGAGAGAGTACGG + Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1164296854 19:23918198-23918220 AAGGGGGAACACAGAGAGTAAGG + Intronic
1164425998 19:28142463-28142485 AAGGGGAGAGGGAGGGAGAACGG + Intergenic
1164526269 19:29015744-29015766 AAGGAGAGAGAGAGGGAGAGAGG - Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1164654340 19:29909997-29910019 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654365 19:29910077-29910099 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654390 19:29910157-29910179 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164654522 19:29910614-29910636 AAGGGGGGAGAGAGGGAGAGAGG - Intergenic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1165080785 19:33304781-33304803 AGGAGGAGACAGAAGGAGTAGGG + Intergenic
1165322639 19:35095762-35095784 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165885344 19:39074138-39074160 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166377316 19:42334844-42334866 AAAGGGAGACAGAGAGAGACAGG - Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1166548572 19:43649632-43649654 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
1166573109 19:43811720-43811742 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1166948034 19:46409127-46409149 AAGGGGAGGGAGAGGGAGAGGGG + Intergenic
1167102929 19:47415123-47415145 GGGGGGAGACAGAGGGAATTGGG + Intronic
1167763658 19:51464470-51464492 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1168271874 19:55254557-55254579 AAGGGGTGACAGATGAAGCATGG - Intronic
1168631721 19:57961965-57961987 AAAGGGAGAGAGAGAGAGAAAGG - Intronic
1202655352 1_KI270708v1_random:15606-15628 AGGGGGAGAAACAGGGATTATGG + Intergenic
925079362 2:1051141-1051163 AGGGGGAGAGGGAGGGAGGAAGG - Intronic
925188727 2:1866564-1866586 AAGGGGAGAGAGAGAGAGGCAGG + Intronic
925800482 2:7594431-7594453 GAGGGGAGACAGTGGGAGCCAGG - Intergenic
925833289 2:7917637-7917659 AGGGAGAGAGAGAGGGAGGAAGG + Intergenic
925916791 2:8612684-8612706 ACGGGGAGACACAGGGGGTAAGG + Intergenic
925933851 2:8734149-8734171 AAGGGGAGGCAGCAGGAGTGGGG + Intronic
926540982 2:14181621-14181643 AAAGGGAGACATAGGGAGAGGGG - Intergenic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926882564 2:17563141-17563163 AAGGTGAGATAAAGGGAGAAGGG + Intronic
926946501 2:18193301-18193323 TAGGGGAGACAGAGTGAAAATGG + Intronic
927192647 2:20527395-20527417 ATGGGGAAACTGAGGCAGTAGGG + Intergenic
927249098 2:20982112-20982134 AGAGGGAGACAGAGGGACAAAGG - Intergenic
927287512 2:21371705-21371727 AAGGGGAGAGAAAGGGAGGGAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927783727 2:25958224-25958246 AAGGGGACACTGAGGCAGTGGGG - Intronic
927990456 2:27443359-27443381 ATGGGGAGTAGGAGGGAGTAGGG - Intronic
928194623 2:29206279-29206301 AGGGGGAGAGAGAGGGAGGGAGG - Intronic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928702767 2:33915948-33915970 AGGGGGAGAAATAGGGATTACGG - Intergenic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929023550 2:37577447-37577469 GAGGGAAGACAAAGGGAATATGG - Intergenic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929475448 2:42242646-42242668 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
929526358 2:42706953-42706975 AGGGGAAGAGGGAGGGAGTAGGG - Intronic
929667262 2:43842690-43842712 AAGGGGACACAGTAGGAGTGCGG - Intronic
929671072 2:43876721-43876743 ATGGGGAGACTGTGGGAATATGG + Intronic
929671105 2:43876896-43876918 ATGGGGAGACTGTGGGAATATGG + Intronic
929824999 2:45303132-45303154 ATGGGGAGAGAGAGGGAGCTGGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
929927788 2:46229941-46229963 AAGGGGAGGGAGAGAGAGTGAGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930371012 2:50501192-50501214 AAGGGGAGACGGATGAAGGAAGG + Intronic
930999094 2:57759928-57759950 AAAGGGAGAGAGGGGGAGTGAGG + Intergenic
931161098 2:59691520-59691542 AAGGGGAGAGAAAGGGAGCTAGG - Intergenic
931339232 2:61382492-61382514 AGTGTGATACAGAGGGAGTATGG - Intronic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932781265 2:74560101-74560123 AAGGGGAGGGAGGGGAAGTAAGG + Intronic
932957155 2:76365991-76366013 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933188120 2:79301658-79301680 AAGGGGAGACAGGGGAGATAGGG - Intronic
933341490 2:81032216-81032238 AAGGTGAGACAGAGAGAGATGGG - Intergenic
933378528 2:81513385-81513407 AAGATGAGAAAGAGGGAGGAGGG + Intergenic
933441092 2:82315363-82315385 AAAGGGAGAGAGAGGGAAGAGGG - Intergenic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934031679 2:88054657-88054679 AAAGGGAGATGAAGGGAGTAGGG - Intronic
934049965 2:88201528-88201550 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934049997 2:88201838-88201860 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934606632 2:95700204-95700226 GAGGGGAGAATGAGGAAGTAAGG - Intergenic
934716450 2:96547375-96547397 AAGGAGAGAGGGAAGGAGTAAGG - Intronic
934765040 2:96875931-96875953 ACAGGGAGACAGAGGAAGGAGGG + Exonic
934781290 2:96971291-96971313 AAGGAGAGAGAGAGGGAGGTGGG - Intronic
935028618 2:99301422-99301444 AAGGAGAGAGAGAGTGAGAAGGG + Intronic
935029369 2:99307083-99307105 AAGGAGAGAGAGAGTGAGAAGGG - Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935358447 2:102226659-102226681 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
935677458 2:105608340-105608362 AGGAGGAGCCAGAGGCAGTAAGG - Intergenic
935788016 2:106566690-106566712 AAGGGGAGAGGAAGGGAGGAAGG - Intergenic
935933625 2:108156961-108156983 AAGGAGAGAGGGAGGGAGAAAGG + Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936540036 2:113342333-113342355 GAGGGGAGAATGAGGAAGTAAGG - Intergenic
936673184 2:114683539-114683561 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
936779877 2:116019285-116019307 AATGGGAGGCATTGGGAGTAGGG + Intergenic
936898547 2:117457411-117457433 AAGGGGAGAGAGTGGGAGTGTGG - Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937335999 2:121062703-121062725 GAGGGGCGGCAGTGGGAGTAGGG - Intergenic
937476653 2:122221245-122221267 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938122147 2:128641548-128641570 AAGGAGAGACAGAGGCACCAGGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938409002 2:131048430-131048452 AAGGGGAGACAGAGGATGAGCGG - Exonic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
938693128 2:133810684-133810706 AAGGGGAGAAAGAGAAAGTGTGG + Intergenic
939223862 2:139339892-139339914 GAGGGGAGAGAGAGAGAGGAGGG + Intergenic
939945825 2:148409414-148409436 AAAGGGAGAGAGAGAGAGAAAGG + Intronic
940015085 2:149095803-149095825 GATGGGAGACAGAGGGAGATAGG + Intronic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
940119647 2:150249891-150249913 AAGGAGAGAGAGAGAGAGAAAGG + Intergenic
940301320 2:152178709-152178731 AGGGGGAGAAATAGGGATTATGG - Intergenic
940541618 2:155027758-155027780 AAGGAAAGAAAGAGGGAGAAAGG - Intergenic
940575120 2:155493716-155493738 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
940729923 2:157376687-157376709 AGAGGGAGAGAGAGAGAGTAGGG + Intergenic
940777330 2:157898402-157898424 AGGGGGAGAGAGAGGAAGGAAGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941196333 2:162456868-162456890 AAGGAAAGAGAGAGAGAGTATGG - Intronic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941539003 2:166758975-166758997 AAAGGGAGAAAAAGGGAGAAAGG + Intergenic
941770356 2:169338145-169338167 AAGGAGGAAGAGAGGGAGTAGGG + Intronic
941987953 2:171526414-171526436 GAGGGGAGAGAGAGGGGGAAAGG - Intronic
942568926 2:177293874-177293896 AGGGGGAGAAGGAGGGACTAAGG - Intronic
943343067 2:186704849-186704871 AAGAGAAGAGAGAGGGAGTCAGG + Intronic
943499254 2:188666190-188666212 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
943516917 2:188899999-188900021 AAGAGGAGCCAGAGGGAGATCGG - Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944525220 2:200612014-200612036 AGGGGGAGAAAGAGCGAGAATGG - Intronic
944651726 2:201837368-201837390 AGGGGGAGAGAGGGGGAGAAGGG + Intronic
945546788 2:211164708-211164730 GAGGGGAGAGAGAGGCAATAGGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945996717 2:216443257-216443279 TATGGGAGACTGAGGGAGGAGGG + Intronic
946130273 2:217601261-217601283 AAGCAGAGAGAGAGGGAGCAAGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946276085 2:218632912-218632934 GAAGGGAGGCAGAGGGAGAAGGG + Intronic
946294648 2:218774244-218774266 TAGGAGAGACAGAGAGAGAAAGG + Intergenic
946359107 2:219208365-219208387 AAGGGGAAAAAGGGGGAGCAGGG - Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946707867 2:222476350-222476372 AGGTGGTGACAGAGGGACTAGGG + Intronic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947159084 2:227193869-227193891 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947159101 2:227193936-227193958 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947395239 2:229680227-229680249 AAGGTGACGCAGAAGGAGTATGG + Intronic
947959345 2:234221911-234221933 TAGAGGTGTCAGAGGGAGTATGG - Intergenic
947998014 2:234544777-234544799 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
947998723 2:234549709-234549731 AAGGAGAGAAGGAGGGAGAAAGG - Intergenic
948010419 2:234646910-234646932 GTAGGGAGACAGTGGGAGTAGGG - Intergenic
948010941 2:234648994-234649016 GTAGGGAGACAGTGGGAGTAGGG - Intergenic
948255670 2:236566883-236566905 AGGGAGAGACAGAGAGAGAAAGG - Intergenic
948589209 2:239038684-239038706 AAGAGGAGACACACGGAGAAGGG - Intergenic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948686771 2:239675071-239675093 AAGGGGTGAGGAAGGGAGTAAGG + Intergenic
948719063 2:239884853-239884875 AAGGAGAGACAGAGAAAGAAAGG + Intergenic
948797820 2:240413632-240413654 ATGGAGAGAGAGAGGGAGTGGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948845689 2:240681858-240681880 AAGGGGTGATAGAGGGTGCAGGG + Intronic
948848166 2:240692872-240692894 AAGGGGTGATAGAGGGTGCAGGG - Intronic
1169030036 20:2399934-2399956 AATGAGAGACAGAGGGAGCTAGG - Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169169834 20:3456013-3456035 AAGGAGAGAGAGAGAGAGAAAGG + Intergenic
1169325603 20:4673107-4673129 AGAGGGAGAGAGAGGGAGGAAGG - Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1169953207 20:11071402-11071424 AAGAGGTGTCAGAAGGAGTAAGG - Intergenic
1170000436 20:11608351-11608373 AAGTGGAGAAAGTGGGAATAGGG - Intergenic
1170416870 20:16153022-16153044 AAGGGGAGAGAAAGAGAGAAAGG + Intergenic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170545711 20:17434222-17434244 AAGGAGAGAGAGAGGGAGAGAGG - Intronic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170680596 20:18522137-18522159 AAGGGTAGAGACACGGAGTAGGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171229504 20:23472140-23472162 AAGGGGAGAGACAGAGAATATGG + Intergenic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1172126578 20:32628126-32628148 AAGGGGAGAGAGAGGAAGTGTGG + Intergenic
1172154066 20:32811193-32811215 TGGGGGACTCAGAGGGAGTATGG + Intergenic
1172171745 20:32939637-32939659 AAAGAGAGACAGAGAGAGAAAGG - Intronic
1172204459 20:33153043-33153065 AAGGGGAGAAAGCAGGAGTGGGG - Intergenic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172260306 20:33558464-33558486 AAAGGGAGATGGAGGGAGTTAGG - Intronic
1172321614 20:33999387-33999409 AAAGGGAGAGAGTGAGAGTATGG + Intronic
1172442865 20:34978099-34978121 AAGTGGAGACAGAGGGGGAGGGG + Intronic
1172476051 20:35238566-35238588 AAGGGGTTGCAGAGGGAGTCAGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172599416 20:36173607-36173629 AGGGAGAGACAGAGGAAGTGGGG - Intronic
1172873142 20:38148106-38148128 AAGAGGAGAAAGAGGGAGCTGGG + Intronic
1172912457 20:38420110-38420132 ATGGGGTAACAGTGGGAGTAGGG - Intergenic
1173114807 20:40230951-40230973 AAGGAGGGAGAGAGGGAGTCAGG + Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173150812 20:40565313-40565335 TAGGGGAGAGGGAGGGAGAATGG + Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173439797 20:43066114-43066136 AAGGAGAGAGAGAGAGAGTTGGG - Intronic
1173572588 20:44087146-44087168 AAGGAGAGAAGGAGGGGGTAGGG - Intergenic
1173795387 20:45856154-45856176 AACGGGAGACTGAGGCAGAAGGG + Intronic
1173865829 20:46312264-46312286 AGAGGGAGACAGAGGGAGACTGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1173982681 20:47236959-47236981 AAAGGGAGAATGAGGGAGTAGGG - Intronic
1174008900 20:47433051-47433073 AGGGGGAGAGAGAGTGAGGAAGG + Intergenic
1174187893 20:48719982-48720004 AGGGAGAGAGCGAGGGAGTAAGG - Intronic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1174477471 20:50806361-50806383 AAAGGGAGAAAGAGAGAGAAGGG - Intronic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1174832391 20:53824895-53824917 CAGGGGAGACTGAGGCAGTGAGG - Intergenic
1174856529 20:54050705-54050727 AAGGGGAGGCAGAGCGTGGACGG - Intronic
1174958570 20:55129653-55129675 AAGGGAAGAAAGAGAGAGAAAGG - Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175230582 20:57471098-57471120 AAGGGGAGAGAGAGAGAGAGAGG - Intergenic
1175438905 20:58976839-58976861 AAGGAGAGAGAGAGACAGTAAGG - Intergenic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1175531056 20:59674520-59674542 AAGGGGAGACAGAAGAAGCGGGG - Intronic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1175921420 20:62452096-62452118 GCGGGGAGAGAGAGGGAGAAGGG + Intergenic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176632269 21:9150766-9150788 ATGGGGAGAAACAGGGATTACGG - Intergenic
1176641040 21:9304051-9304073 AGGGGGAGAAACAGGGATTACGG + Intergenic
1176719126 21:10379135-10379157 CAGGGGAGAGAGAGAGAGTGGGG - Intergenic
1177188504 21:17824002-17824024 AAGGGGAGAGAGACAGAGCAAGG + Intergenic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1177373081 21:20231939-20231961 AAGGGTAGACGGAGAGAATAGGG - Intergenic
1177410803 21:20728457-20728479 AAGGAGAGAAAGAGGGAGTGAGG + Intergenic
1177421672 21:20867348-20867370 AGGGGGACAGAGAGGGAGAAAGG - Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177674377 21:24277323-24277345 GAGGGGAGAGGGAGGGAGTGGGG - Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1178043934 21:28673030-28673052 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1178045178 21:28685757-28685779 AAAGGGAGAATGAGAGAGTAGGG + Intergenic
1178100347 21:29261476-29261498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1178307590 21:31503416-31503438 AAGAGGAGAAAGAGAGAGGAAGG + Intronic
1178416136 21:32406648-32406670 GAGGGTGGAGAGAGGGAGTAGGG + Intergenic
1178481094 21:32979621-32979643 AAGGGGAGATAGAGAAAGAAGGG + Intergenic
1178824631 21:36004965-36004987 AGGGGGAGACAGGGGGAGGCAGG + Intergenic
1179137212 21:38690125-38690147 AAAGAGAGACAGAGAGAGAAAGG - Intergenic
1179194772 21:39154778-39154800 AAAGAGAGAAAGAGGGAGAAGGG + Intergenic
1179462326 21:41545599-41545621 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1179540860 21:42082606-42082628 AGGAGGACACAGAGGGAGGAGGG - Intronic
1180081872 21:45490841-45490863 AAAGGGAGACAGAGGCAGCCGGG + Exonic
1180090774 21:45532967-45532989 AAGGGGAAAGAGAGGAAGTGGGG + Intronic
1180186868 21:46144560-46144582 GGAGGGAGACAGAGGGAGGAGGG - Intronic
1180340606 22:11614754-11614776 TAGGGGAGAAAGAGAGAGAAAGG + Intergenic
1180350061 22:11793436-11793458 AGGGGGAGAAACAGGGATTACGG + Intergenic
1180374343 22:12076877-12076899 AGGGGGAGAAACAGGGATTACGG + Intergenic
1180388147 22:12198820-12198842 AGGGGGAGAAACAGGGATTATGG - Intergenic
1180673887 22:17573813-17573835 AAGTGGAGAGGGAGGGATTAGGG - Intronic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181419628 22:22788866-22788888 AAGGAAAGGCAGAGGGAGAAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181786045 22:25228004-25228026 ATGGGCAGAGAGAGGGAGTAGGG - Intronic
1181819196 22:25462556-25462578 AGGGGGAGGAAGAGGGAGGAAGG - Intergenic
1181960313 22:26617904-26617926 AAAGGGAGACAGAGAGAGGGAGG - Intronic
1182007042 22:26969715-26969737 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1182292255 22:29289475-29289497 AAGGGCAGGCAGAGGCAGCAGGG - Intronic
1182439962 22:30357312-30357334 AAGGGGGGACTAAGGGAGTAGGG - Intronic
1182446173 22:30390856-30390878 AAGGAGAGACAGAGGAATTGGGG - Intronic
1182550878 22:31100179-31100201 AAAGGGAGAGAGAGGGAGAAGGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182953167 22:34396529-34396551 AAGGGGAGAGAGAGAGGGAAGGG - Intergenic
1182962429 22:34488257-34488279 AAGGGGGGAGAGAGGAAGGACGG - Intergenic
1183037521 22:35151330-35151352 ATGGAGAGAAAGAGGGAGTGAGG - Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183089747 22:35513764-35513786 AGGGAGAGCCAGAGGGAGAAAGG + Intergenic
1183197487 22:36363446-36363468 AGGGAGAGACAGAGGGAGGCAGG + Intronic
1183738804 22:39658847-39658869 AGAGGAAGACAGAGGGAGAAGGG - Intronic
1183950221 22:41348595-41348617 AAGGGGAACAAGAGGGAGAAAGG - Intronic
1184018935 22:41807647-41807669 AAGGGGAGAAAGAGGAAGGGTGG + Intronic
1184242083 22:43216698-43216720 AAGGGGGGACAAAGGGAGCTTGG - Intronic
1184533506 22:45071428-45071450 AAGTGGAGAGAGAGGGGGTAGGG + Intergenic
1184538157 22:45101540-45101562 AGGGGGAGACAGAGTGGGTGAGG - Intergenic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184863805 22:47191711-47191733 AGGGGGGGAGAGAGGGAGAAAGG + Intergenic
1185001443 22:48248941-48248963 AGGGAGAGACGGAGGGAGGAAGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
949195468 3:1300788-1300810 AGGGGGAGAGAGAGAGAGAAAGG - Intronic
949483648 3:4517251-4517273 AAAGGCAGACAGAGGCAGAATGG + Intronic
949788416 3:7766740-7766762 GAGGGGAGAAAGAGGAAGAAAGG + Intergenic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950401583 3:12773193-12773215 AAGGAGAGAGAGAGGGAGAGAGG + Intergenic
950837605 3:15935774-15935796 AAAAGGAAACAGAGGGAGCAAGG - Intergenic
951033002 3:17903756-17903778 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
951194397 3:19807555-19807577 GAGAAGAGAAAGAGGGAGTAGGG + Intergenic
951388480 3:22072678-22072700 AAAAGGAGAAAGAGGGAGAAAGG + Intronic
952556596 3:34538501-34538523 AAGGAGAGAGAGAGAGAGAATGG - Intergenic
953072459 3:39534917-39534939 AAGGAGAGAGGGAGGGAGAAAGG - Intergenic
953357462 3:42266747-42266769 AAGGAGAGACGGAGGGAGGGAGG - Intergenic
953811594 3:46117318-46117340 AAGGGGCAACAAAGGGATTAGGG - Intergenic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954712346 3:52511471-52511493 ATGGGGAGACAGAGGCCCTAAGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
955228784 3:57081153-57081175 AAGGGGAGAAAGAGGCTGGAGGG + Intergenic
955349762 3:58184704-58184726 AAGGGGAGAGAGACTGAGCATGG + Intergenic
955629271 3:60954759-60954781 AAGGGGAGGCAGATAGATTAGGG + Intronic
955874539 3:63476050-63476072 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955991220 3:64629447-64629469 TAGGGAAGACGGAGGCAGTATGG - Intronic
956147836 3:66210112-66210134 AAAGGGAGAAGGAGGGAGGAAGG - Intronic
956402531 3:68895573-68895595 AAGGGGAGATACAGTGGGTAGGG + Intronic
956500798 3:69882981-69883003 AGGGAGAGACAGAGGTAGTGGGG - Intronic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
956932781 3:74064402-74064424 GAGGGGAGACAGAGAAAGGAGGG + Intergenic
957099114 3:75806513-75806535 AGGGGGAGACAGAGGGATTATGG - Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
957543206 3:81603020-81603042 TAGAGGAGCCATAGGGAGTAAGG - Intronic
958171728 3:89947543-89947565 AAGAGGTCACACAGGGAGTAGGG - Intergenic
958749111 3:98174327-98174349 AAGGGGTGACAGAGGGCATCTGG + Intronic
958878082 3:99638357-99638379 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
958933728 3:100235230-100235252 AAGGGGAGACTGAGGCAGTAAGG + Intergenic
959276497 3:104283329-104283351 AAGGAGAGAAACAGGGACTACGG - Intergenic
959314757 3:104789099-104789121 AAAGGGAGAGAGAGGGAGAGAGG + Intergenic
959445630 3:106435578-106435600 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
960195694 3:114765065-114765087 AAGAGGAGACAGAGGAGGTGAGG + Intronic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
960641046 3:119823514-119823536 AAGAGGAGAGAGAGAGAGCATGG + Intronic
960959535 3:123060273-123060295 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
961330677 3:126136116-126136138 AAAGGGAGAGGGAGGGGGTAGGG - Intronic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961445362 3:126978122-126978144 ACGGGAAGTCAGAGGGAGGAGGG + Intergenic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961917321 3:130390713-130390735 ACCTGGAGCCAGAGGGAGTAGGG + Intronic
962222202 3:133573618-133573640 GAGGGGAGGGAGAGGGAGGAGGG - Intergenic
962299813 3:134229328-134229350 AAGGAGAGACAGAAGGGGTTGGG - Intronic
963066251 3:141266634-141266656 AGGGAGAGACAGAGGGAGAGAGG + Intronic
963113103 3:141702479-141702501 TAGGGGAGAGAGAGAGAGAAAGG + Intergenic
963211497 3:142697418-142697440 AAGGGGAGTATGAGAGAGTAAGG - Intronic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
964119196 3:153164036-153164058 AAGGGGAGTCTGGGGGAGAATGG + Exonic
964178427 3:153854830-153854852 AGGGGGAGAAAGAGGGAGTGGGG - Intergenic
964590533 3:158358789-158358811 AAACGGAGACAGAGGGAGAATGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
964766163 3:160179824-160179846 AAGGGCAGAAAGAGGGAGAGGGG + Intergenic
965230402 3:166043756-166043778 AAGGGGGGTCAGAGGGAATGGGG + Intergenic
965429956 3:168574285-168574307 AAAGAGAGAAAGAGGGAATAGGG - Intergenic
965631873 3:170741242-170741264 AGGAGGAGAGAGAGGGAGGAGGG + Intronic
966060541 3:175749208-175749230 AAGGGGAGGGAGAGGGGGTAGGG + Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966446984 3:180011741-180011763 AAGGGATGAAAGAGGGAGTGAGG - Intronic
966540933 3:181088895-181088917 AAGGAGAGACAGAGAAAATATGG + Intergenic
966763985 3:183442299-183442321 CAGGAGAGAAAAAGGGAGTAGGG - Intergenic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967577330 3:191108817-191108839 ATGGGGAGAAAGAGAGAGAAGGG - Intergenic
967678001 3:192323562-192323584 AAAGGGGGACATGGGGAGTAGGG + Intronic
967853689 3:194100761-194100783 AAAAGGAGAGAGAGGGAGGAAGG + Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
1202745853 3_GL000221v1_random:100975-100997 AGGGGGAGAAACAGGGATTACGG - Intergenic
968695053 4:2020339-2020361 AAAGGGAGAGGGAGGGAGGAAGG - Intronic
968887198 4:3341287-3341309 AAGGGTAGAGAGATGGGGTATGG + Intronic
969495318 4:7523048-7523070 AAGGGGAGAGAAGGGGAGGAAGG - Intronic
969607800 4:8211201-8211223 AGGGGGAGAGGGAGGGAGTGGGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969607896 4:8211465-8211487 AGGGGGAGAGGGAGGGAGAAGGG - Intronic
969851536 4:9960888-9960910 AAGGCTAGACTGAGGGATTAGGG + Intronic
970184376 4:13434161-13434183 AAGAGGAGACAGATGGAGTGGGG + Intronic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971483400 4:27134541-27134563 AAGGAGAGGCAGAGAGAGAAAGG + Intergenic
971661703 4:29426129-29426151 AAGGAGAGAAAGAGGGAGAGAGG - Intergenic
972061634 4:34881636-34881658 AAGGAGGGAGAGAGGGAGAAAGG - Intergenic
972281464 4:37605956-37605978 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972607379 4:40626280-40626302 AAAGGCAGACAGTGGGAGTATGG + Intronic
972929539 4:44054631-44054653 AGGGGGAGAGAGAGAGAGAAAGG + Intergenic
973331046 4:48910394-48910416 GAGGGGAGAGAGAGGAAGGAAGG - Intergenic
973336245 4:48959389-48959411 GAGGAGAGCCAGAGGGAGAAGGG + Intergenic
973567408 4:52202155-52202177 AAGAGGAGACTGAGGCAGTTAGG - Intergenic
973626355 4:52776444-52776466 AAAGGGAGAGAGAGAGAGAAAGG + Intergenic
973745798 4:53962356-53962378 AAGGGGAGAAGGATGGAGAAAGG + Intronic
974542684 4:63258457-63258479 AAAGGGAGAATGAGGGAATAGGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
975735232 4:77373984-77374006 AGGGGTAGACAGAGGAAGTTAGG - Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976059247 4:81107136-81107158 AAGAGGAGAAAGACGGAGTTGGG + Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976158327 4:82172002-82172024 AACTGGAGACAGAGGAAGGAAGG + Intergenic
976615225 4:87069426-87069448 ATAGGGAGAGAGAGGGAGAAGGG - Intronic
976768478 4:88623532-88623554 AGTGGGAGACAGAGAGAGTTAGG - Intronic
976849451 4:89528637-89528659 AAGAGGAGACAGAGGGTTTGTGG - Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977642350 4:99371282-99371304 AAGGGGAGAAACAGGGACTATGG + Intergenic
977808251 4:101328911-101328933 AAGGAGAGACAGAGAGAGATGGG - Intronic
977919221 4:102625194-102625216 AAAGGGAGAAAGAGGAAGGAGGG - Intergenic
978072429 4:104490681-104490703 AAGGGGAGAGGGAGTGAGGAGGG + Intronic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
978660564 4:111121145-111121167 GAGGGGAGAGAGAGGGAGTGTGG - Intergenic
978667337 4:111200029-111200051 AAAGGGAGCCAGAGAGAGTGGGG - Intergenic
978833017 4:113112422-113112444 AGGGGGAGACAGAATGTGTATGG + Intronic
978981437 4:114951043-114951065 AAGGGGAGAAGGAGGGAATAAGG + Intronic
979017654 4:115454571-115454593 ATGGGGAGACAGAGAGAAAAGGG + Intergenic
979681590 4:123466165-123466187 AAGGGGAGACAGTGGAAGAAAGG + Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
980071363 4:128245751-128245773 AAAGGAAGAGAGAGAGAGTAAGG - Intergenic
980457536 4:133065299-133065321 AACAGGAGAAAGAGGGAGTGGGG + Intergenic
980857851 4:138462083-138462105 AAGAGGAGATGGAGGGAGTTTGG - Intergenic
980877229 4:138673923-138673945 AAGGAGAGAGAGAGGGAGAGAGG + Intergenic
980896993 4:138869147-138869169 AAGGGGAGAGAGAGGGTGAGGGG + Intergenic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
982277934 4:153656013-153656035 AAGGGGTGGCAGAGGGAGGATGG - Intergenic
983527835 4:168778245-168778267 ACTGGGAGACAGTGGGAGGATGG + Intronic
983552533 4:169032293-169032315 AAGAGGAGAGAGAGGGAATAAGG - Intergenic
983691044 4:170469578-170469600 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
984029303 4:174583464-174583486 AAAGGGAGGGTGAGGGAGTAAGG - Intergenic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984484088 4:180344864-180344886 AAAGGCAGACACAGGTAGTAGGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984885179 4:184443358-184443380 AAGGGGAGAGAGAGGAAGTAGGG - Intronic
985099711 4:186446743-186446765 AAAGGGAGAGAGAGGGAGGGAGG - Intronic
985219230 4:187685223-187685245 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
985268941 4:188176404-188176426 AGAGGGAGACAGAGGGAGAGAGG + Intergenic
985445784 4:190020763-190020785 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1202755926 4_GL000008v2_random:62316-62338 AGGGGGAGAAACAGGGATTACGG + Intergenic
985756646 5:1723446-1723468 GAGAGGAGAGAGAGGGAGTGAGG - Intergenic
985781603 5:1874516-1874538 ATGGGGAGAGAGAGGGAGGCCGG + Intergenic
985982856 5:3486831-3486853 AAAGTGAGACAGAGTGAGTCAGG - Intergenic
985983150 5:3488936-3488958 AAAGGGAGAGAGAGGGAGAGGGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986080953 5:4393853-4393875 AAGGGGAGAAAAAGTGTGTATGG + Intergenic
986472844 5:8093238-8093260 TGGGAGAGACAGAGGGAATAGGG + Intergenic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
987602931 5:20095476-20095498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
987766941 5:22244589-22244611 AAGGAAAGACAGAGAGAGAAAGG + Intronic
987824582 5:23012581-23012603 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
987866120 5:23541830-23541852 AAAGGGAGAGAGAGAGAATATGG - Intergenic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
988329372 5:29815178-29815200 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
988435294 5:31167414-31167436 AAGGGGAGGGAGAGAGGGTATGG - Intergenic
988628985 5:32909160-32909182 AAAGGGAGAGAGAGAGAGAAAGG + Intergenic
988773073 5:34450999-34451021 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
988893558 5:35647313-35647335 AAAGTGAGAGAGAGGGTGTAGGG + Intronic
989278304 5:39613320-39613342 AAAGGAAGAATGAGGGAGTAGGG - Intergenic
989588946 5:43095768-43095790 AAAGGGAGACTGAGGGAATAGGG - Intronic
989991320 5:50770622-50770644 AAGGAGGGAGGGAGGGAGTAAGG + Intronic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990364619 5:55057721-55057743 AGTGGGAGACAGAGGGTGGACGG + Intergenic
990535309 5:56715877-56715899 AAGAGGAGAGAAAGGGAGGAAGG + Intergenic
990636389 5:57732459-57732481 AAGGGGAGACGTAAGCAGTATGG + Intergenic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
990850168 5:60194172-60194194 AGGGGTAGACAGTGGGAATAAGG - Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991187429 5:63826368-63826390 AAAGGGCGGGAGAGGGAGTACGG - Intergenic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992001522 5:72441125-72441147 ATGTTGAGACAGAGAGAGTATGG - Intergenic
992002851 5:72452249-72452271 AAAGGGAGAGAGAGGGAGGGAGG + Intronic
992023133 5:72644638-72644660 AAGAAGAGAAAGAGAGAGTATGG + Intergenic
992180561 5:74193263-74193285 AAGGAGAGACAGAGGTGGAAGGG + Intergenic
992575591 5:78107430-78107452 AAAGAGAGAGAGAGGGAGCATGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993003604 5:82407165-82407187 AAGGGGAGATGGAGGCAGTAGGG + Intergenic
993375063 5:87141090-87141112 AGGGGGAGAGGGAGGGAGGAAGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994084579 5:95744033-95744055 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
994088773 5:95789689-95789711 AAGGAGAGAGAGAGGGAGTAAGG + Intronic
994117718 5:96079614-96079636 AAGGGGAGACAGAGAGAACTAGG - Intergenic
994331407 5:98510550-98510572 AACGGGTGAAAGAGGGAGTGGGG - Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995024178 5:107399412-107399434 AAGGAGAGAGAGAGAGAGAAAGG + Intronic
995331270 5:110949658-110949680 AAGGGAGGGCAGAGGGAGAATGG - Intergenic
995796567 5:115947326-115947348 AAGGTGAGGAAGAGGGAGTTGGG - Intergenic
996030597 5:118700108-118700130 AAGGAGAGAGAGATGGAGTTAGG - Intergenic
996480467 5:123970062-123970084 AGGGGGAGAGGGAGGGAGTTTGG - Intergenic
996797463 5:127364842-127364864 AATGGGAGTGAGAGGGAGTAGGG - Intronic
997294362 5:132760514-132760536 AAGGAGAGAAAAAGGGAGAAGGG + Intronic
997338822 5:133126673-133126695 AGGGGGAGAGAGTGGGAGGAGGG + Intergenic
997952773 5:138255012-138255034 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
998295547 5:140966446-140966468 AAGGGAAGACAGAGGGGGAGGGG - Exonic
998394134 5:141807156-141807178 ATAGGGAGAGAGAGGGAGGAAGG + Intergenic
998400285 5:141845274-141845296 TTGGGGAGAAAGAGAGAGTAGGG - Intergenic
998467911 5:142360601-142360623 AGGGGGAGACAGAGGGATTCAGG - Intergenic
998581720 5:143384114-143384136 AGGAGGAGACAGAGAGAGAAGGG + Intronic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999690126 5:154139326-154139348 AAGGGAAGAGAGGGAGAGTAAGG - Intronic
999943214 5:156567326-156567348 AAGGAGAGAGGGAGGGAGTGAGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1000391367 5:160726656-160726678 AAGGGGAGGAGGAAGGAGTAGGG + Intronic
1000419585 5:161023069-161023091 AAGTAGAGAGAGAGGGAATAAGG + Intergenic
1000508106 5:162147338-162147360 AAAGAGAGACAGAGGAAGGAAGG - Intronic
1000969942 5:167703004-167703026 AGAGGGAGACAGAGGGAGAGAGG - Intronic
1001029871 5:168254459-168254481 AAGGGGAGGAAGAGGAAGAAGGG + Intronic
1001029881 5:168254501-168254523 AAGGGGAGGAAGAGGAAGAAAGG + Intronic
1001312093 5:170618432-170618454 AGGGGGAGAGGGAGGGAGAAAGG + Intronic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1001441877 5:171749783-171749805 AAGGGGAGTCACAGGGACTAAGG - Intergenic
1001442059 5:171750743-171750765 AAGGGGAACCAGAGGGGGTAGGG - Intergenic
1001445542 5:171779852-171779874 AAGGAGAGAGAGAGGGAGAAGGG + Intergenic
1001484102 5:172107183-172107205 AAGGGGGGAGAGAGAGAGCAAGG + Intronic
1001511071 5:172322374-172322396 AAGGAGAGAGATAGGGAGGAAGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1002008194 5:176253131-176253153 AAGGGGAGACAGAGAGGGAGAGG + Intronic
1002169439 5:177367063-177367085 AAAGGGAGACAAAAGGAGCAGGG + Intronic
1002334057 5:178466003-178466025 GAGGGGAGACTGAGGGACCAGGG - Intronic
1002372317 5:178765056-178765078 AAGGGGAGAGAGAAGGAATGGGG - Intergenic
1002382107 5:178838613-178838635 AAAGGGAGAATGAGGGAATAAGG + Intergenic
1002648618 5:180674652-180674674 AAAGGGAGAATGAGGGAATAAGG - Intergenic
1002851742 6:1003081-1003103 AAAGGGAGAGAGAGGGAGGTGGG - Intergenic
1002910081 6:1483414-1483436 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003016040 6:2468261-2468283 AATGGGAGACAGAGAGGGAAGGG + Intergenic
1003016084 6:2468522-2468544 AGGGAGAGAGAGAGGGAGCAAGG + Intergenic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003634435 6:7819536-7819558 AAGGGGAGAGAAAGGAAGAAAGG + Intronic
1003837128 6:10083857-10083879 AGGGAGAGACGGAGGGAGGAAGG + Intronic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004582674 6:16969629-16969651 AAGGGAAGAGGGAGGGAGAAAGG + Intergenic
1004725633 6:18308847-18308869 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1004725648 6:18308917-18308939 AAGGGAAGAGAGAGAGAGGAAGG - Intergenic
1004883409 6:20030646-20030668 AAGAGGAGACAGGAGAAGTAGGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1005579991 6:27224734-27224756 AGGTGGAGAATGAGGGAGTAGGG - Intergenic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1005693388 6:28328946-28328968 AAGGAGAGAAAGAGAGAGAAAGG - Intronic
1006096225 6:31658502-31658524 CATGGGAGCCAGAGGGAGTGGGG - Exonic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006598154 6:35208638-35208660 GAGGGGTGGCAGAGGGAGTCTGG + Intergenic
1006724547 6:36188260-36188282 GAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1006970851 6:38043503-38043525 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
1006994475 6:38245509-38245531 AGAGGGATGCAGAGGGAGTATGG + Intronic
1007046753 6:38783529-38783551 AAGGAGAGACACAGGAAGGAAGG - Intronic
1007292744 6:40799585-40799607 AAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1007482332 6:42158341-42158363 AAGAGGAGGAAGAGGGAGTCAGG - Intronic
1007514374 6:42399706-42399728 ATGGGGAAGGAGAGGGAGTAGGG + Intronic
1007615808 6:43179371-43179393 AAGGGGAGGCTGAGGGAGGACGG - Exonic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008263631 6:49397086-49397108 AATGGGAAACATAGGGAGAAAGG + Intergenic
1008265143 6:49415691-49415713 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1008427750 6:51379381-51379403 AAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1008475515 6:51931818-51931840 AGGGGGAGAGAGAGAGAGGAGGG + Intronic
1008475532 6:51931886-51931908 AAGGGGAGAGAGAGAGAGGAGGG + Intronic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1008921740 6:56850117-56850139 AAGGGGAGGTGGAGGGAGGATGG - Intronic
1008948239 6:57123509-57123531 AAGGAGAGAGAGAGAGGGTAGGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009872696 6:69470205-69470227 AAGGGGAGATATAGGGAGGCTGG - Intergenic
1009948359 6:70366066-70366088 AAGGAGGGATAGAGGGAGGAAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012201922 6:96417082-96417104 AAGGGGAGAGAAAGGGAGGGAGG + Intergenic
1012399770 6:98834120-98834142 ATGGGGAAACGGAGGGGGTAAGG - Intergenic
1012519986 6:100109876-100109898 AAGGAGAGAGAAAGGGAGGATGG - Intergenic
1012576384 6:100805358-100805380 AAGGGGAGCGAGAGGGAGTAGGG + Intronic
1012728709 6:102851393-102851415 AATCTGAGAGAGAGGGAGTACGG - Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1013094260 6:106930000-106930022 AAGGGCAGGCACAGGGAGTCTGG - Intergenic
1013587614 6:111593660-111593682 AGGGAGAGACGGAGGGAGGAGGG - Intronic
1013624928 6:111927395-111927417 AAGGGGAGAGAGAGAGTGTGAGG - Intergenic
1013762161 6:113531359-113531381 AAGGGGTGACAGAGGGCACATGG + Intergenic
1014856783 6:126411949-126411971 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1014856824 6:126412070-126412092 AAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1015015918 6:128412841-128412863 AAGGGAAGAAATAGGGAGAAAGG - Intronic
1015047380 6:128792379-128792401 AAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1015112461 6:129609066-129609088 AAGAGGAGAGAGAGGGGGCATGG + Intronic
1015113352 6:129619246-129619268 AAGGGGAGAGAGAGGGGGAGGGG + Intronic
1015335880 6:132037623-132037645 AGGGGGAGAGAGAGAGAGAAGGG + Intergenic
1015395863 6:132733954-132733976 GAGGGGAGAGAGAGAGAGGAAGG + Intronic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1015723727 6:136276400-136276422 AAGGGAGGGCAGAGGGAGAATGG - Exonic
1015944928 6:138489923-138489945 AGGGGGAGACAGGGGGAGAGAGG + Intronic
1016532545 6:145074939-145074961 AAAGGAAGAGAGAGGGAGGAAGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017337710 6:153281857-153281879 AATGGGAGAATGAGAGAGTATGG - Intergenic
1017888498 6:158620520-158620542 AGAGGGAGAAAGAGGGAGCAAGG + Intronic
1018377302 6:163225392-163225414 CAGGTGAGAGAGAGGGAGTGAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019587453 7:1813167-1813189 AAGGGGAGACCAAGGCAGGAGGG + Intergenic
1019825276 7:3279387-3279409 AAGGGGAGAGAGAGGAAGGAGGG + Intergenic
1019954601 7:4403374-4403396 AAGGGGAGAGAGAGAGAGAAGGG + Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020025775 7:4898912-4898934 AAAGAGAGACAGAGGAAGGAAGG + Intergenic
1020078327 7:5273314-5273336 AGGGAGAGACAGAGGGAGACAGG - Intergenic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021116003 7:16747387-16747409 AAGGGGAGAGAGAGGAGGGAAGG - Intergenic
1021224934 7:18015380-18015402 AAGGAGAAACAGAGGGCATATGG + Intergenic
1021262265 7:18472730-18472752 AAGGGGATACAGAGTGACTCAGG - Intronic
1021412479 7:20344063-20344085 ATGGGGACAGAGAGGAAGTAAGG + Intronic
1021447490 7:20749144-20749166 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1021606245 7:22412227-22412249 AAGGGGAGAGAGAGAGAGAGAGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022335426 7:29417257-29417279 AAAGGAAGAGAGAGGGAGGAAGG + Intronic
1022783443 7:33610512-33610534 CAAGAGAGAAAGAGGGAGTAGGG + Intergenic
1022960707 7:35423749-35423771 AAGGGTAGATAGAGGGTGTGGGG - Intergenic
1023009231 7:35910698-35910720 AGGGGGAGAAACAGGGATTACGG + Intergenic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023463962 7:40432890-40432912 AAGGAGAGAGAGAGAGAGAAAGG - Intronic
1023582885 7:41700783-41700805 AGGGGGAGAGAGAGGGAGAGAGG + Intronic
1023737441 7:43247666-43247688 AAGGGGAGAGGGAGGGAGGGAGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024522202 7:50315237-50315259 AAAGGGAGACGGAGGGAGGGAGG + Intronic
1024654154 7:51434906-51434928 AAGGGGAGAGTGAGGGGGCATGG - Intergenic
1024794763 7:53007826-53007848 GGAGGGGGACAGAGGGAGTAGGG - Intergenic
1025200571 7:56958879-56958901 AGGGAGAGACAGAGGGAGACAGG + Intergenic
1025626900 7:63230821-63230843 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025626912 7:63230867-63230889 AGAGGGAGACAGAGGGAGGGAGG + Intergenic
1025671373 7:63618053-63618075 AGGGAGAGACAGAGGGAGACAGG - Intergenic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026123247 7:67556120-67556142 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1026149200 7:67773729-67773751 AAAGGGAGAAAGAGGGAGGGAGG - Intergenic
1026243985 7:68602113-68602135 ATGGGGAGAGAGAGGGAGAGGGG - Intergenic
1026305196 7:69134451-69134473 AAGGGGAGACAGGGAGGGAAAGG - Intergenic
1026329372 7:69338443-69338465 TTGGGGAGACAGGGGGAGTGAGG + Intergenic
1026424003 7:70271402-70271424 AAAGGGAGAGAGAGGTAGAAAGG - Intronic
1026512932 7:71042162-71042184 AAAGGGAGAGAGAGAGAGGAAGG + Intergenic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026591635 7:71701121-71701143 AAGGAGAAAGATAGGGAGTAAGG + Intronic
1026592839 7:71711528-71711550 AGAGGGAGACAGAGGGAGAGAGG - Intronic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1027162656 7:75813810-75813832 AAGGGCAGAGGGAGGGAGTTTGG - Intronic
1027290700 7:76707343-76707365 AAAGAGAGACAGAGAGAGAAAGG + Intergenic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1027416868 7:77983341-77983363 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1029165294 7:98584982-98585004 AAAGGGAGACAGAGGAAGAAAGG - Intergenic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029233984 7:99097273-99097295 GAGGGGAGAGAGAGGGAATGAGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029682046 7:102118045-102118067 AAGGGGAGGCAAAGGCAGTGGGG - Intronic
1029748732 7:102531164-102531186 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1029766679 7:102630248-102630270 AAGGAGAGAGAGAGGAAGGAAGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030294178 7:107903895-107903917 ATGGGGAGATAGAGGAAGGAAGG + Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1030740547 7:113104028-113104050 AAGGGGAGACGGAGGAAGAGAGG - Intergenic
1030811946 7:113983379-113983401 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1031201521 7:118693858-118693880 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1031484592 7:122311705-122311727 AAGAGGAGACAGTGGGAAGAGGG - Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1032322299 7:130896556-130896578 AGGGGGAGAGAGAGGGAGGGAGG - Intergenic
1032503234 7:132415626-132415648 AGGAGGAGAAAGAGGGAGAAAGG - Intronic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1032527230 7:132587980-132588002 AAAGGGAGACAAAAGGAGTCTGG - Intronic
1033036278 7:137878938-137878960 AAGGAGAGACAGAGAGAGAGAGG + Exonic
1033062127 7:138119252-138119274 AAGGAGTGACGGAGGGAGGAAGG + Intergenic
1033368975 7:140691974-140691996 AAGAGGAGACAGAGGGCCTAGGG + Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033822230 7:145148450-145148472 GAGGGGAGACAGAGAAAGAAAGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1034629643 7:152521212-152521234 AAGGGGAGGATGAGGGAGGATGG - Intergenic
1034749844 7:153558517-153558539 AAGGTAAGAGAGAGGGAGCAAGG - Intergenic
1034953232 7:155315577-155315599 AGGGGGAGAGAGAGGGAGGTTGG + Intergenic
1035170878 7:157016887-157016909 AAGGGGAGAGAGATGGGGTGCGG - Intergenic
1035180503 7:157085958-157085980 AAGAGAAGAAAGGGGGAGTAAGG - Intergenic
1035483742 7:159206453-159206475 AAGGAGAGAGAGAGAGAGAATGG + Intergenic
1035753869 8:2016517-2016539 AAGAGGAGACAGAGAGAGTGAGG - Intergenic
1035987371 8:4449687-4449709 AGAGGGAGAGAGAGGGAGTATGG + Intronic
1036154173 8:6326261-6326283 AAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1036207787 8:6818013-6818035 AAAGGGAGAAAAAGGGAGGAAGG - Intronic
1036446162 8:8823022-8823044 AAGGAGAGACAGAGGGACACAGG + Intronic
1036635539 8:10547701-10547723 AAGGGGAGAGGGAGGAAGGAAGG - Intronic
1037548226 8:19944446-19944468 AAGGGGGGAGAGAGAGAGAAAGG + Intronic
1037611722 8:20481534-20481556 AAGGGGACACAGAGGCACAAAGG - Intergenic
1037612038 8:20483994-20484016 AAAAGGACACAGAGGGAGAAAGG - Intergenic
1037656166 8:20886024-20886046 AAAGAGAGACAGAGGGAGGGAGG + Intergenic
1037660082 8:20918847-20918869 TAGGGCAGAGGGAGGGAGTATGG + Intergenic
1037671143 8:21016327-21016349 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
1037859302 8:22393262-22393284 AAGAGGAGGCAGGGGGAGAATGG + Intronic
1038136555 8:24792265-24792287 AAGGGGAGAGAGAGAGAGAGAGG - Intergenic
1038223876 8:25636610-25636632 AGGAGGTGAGAGAGGGAGTATGG - Intergenic
1038327058 8:26579309-26579331 ATGGGGAGAGGGAGGGAGCAGGG - Intronic
1038876441 8:31555659-31555681 AAGGGAAGAGAGAGAGAGAAAGG + Intergenic
1039260520 8:35766326-35766348 AGGGAGAGAAAGAGGGAGGAAGG - Intronic
1039349941 8:36753165-36753187 AAGGTGAGGCGGAGGGAGAAGGG - Intergenic
1039455942 8:37706682-37706704 AAGGAGAGAGAGAGGAAGGAGGG + Intergenic
1039498262 8:37997511-37997533 AGAGGGAGAGAGAGGGAGAAAGG - Intergenic
1039498288 8:37997624-37997646 AAAGAGAGACAGAGGGAGAATGG - Intergenic
1039692004 8:39874065-39874087 AGGGGGAGAAACAGGGATTAAGG + Intergenic
1039840014 8:41286446-41286468 CAAGGGAGGCAGAGGGAGTGTGG + Intronic
1039950189 8:42164948-42164970 AAGGGGAGGGAGAGAGAGGAAGG + Intronic
1039977586 8:42380478-42380500 AGGGGGAGAGAGAGAGAGAAAGG + Intergenic
1040099733 8:43488184-43488206 AAGAGGAGAAAGAGGGAGGTTGG + Intergenic
1040681918 8:49820776-49820798 GAAGGGAGACGGAGGGAGGAAGG + Intergenic
1040963596 8:53061921-53061943 AAAGAGAGAATGAGGGAGTAGGG + Intergenic
1041019286 8:53622164-53622186 AGGGGGAGAAATAGGGACTATGG + Intergenic
1041237669 8:55820831-55820853 AAGGACAGAGAGAGGGAGAACGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042446745 8:68893654-68893676 AGGGGGAGAAATAGGGACTATGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1043803579 8:84643052-84643074 AAGGGGAAAGAGAGAGAGTAGGG + Intronic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044342164 8:91058522-91058544 AAGGGGAGAAGAAGGGAGCAAGG - Intergenic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1044569911 8:93705987-93706009 AATGGGAAAAAGAGGCAGTAGGG - Intronic
1044609382 8:94077331-94077353 AAAGGGAGAATCAGGGAGTAAGG + Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044646162 8:94445429-94445451 AAAGGGAGAATGAGGGAGTACGG - Intronic
1044871057 8:96620360-96620382 AGAGGGAGACAGAGGGAATTAGG - Intergenic
1044878145 8:96693265-96693287 AGAGGGAGAGAGAGAGAGTAGGG + Intronic
1045285814 8:100790464-100790486 AAGTGGAGACACAGAGACTAAGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045681227 8:104662630-104662652 AAGTGGTGACATAGGAAGTAAGG - Intronic
1045714189 8:105022373-105022395 AGGAGGAGAAAGAGAGAGTAGGG + Intronic
1045890363 8:107148957-107148979 AAAGGGAGAGAGAGGTAGCAAGG - Intergenic
1045947895 8:107817502-107817524 AGAGGGAGACAGAGAGAGGAAGG + Intergenic
1046030446 8:108776773-108776795 GAGGAGAGAAAGAGGGAGTGGGG + Intronic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046221829 8:111226788-111226810 AAGGGAAAAGAGAGGGAGTTTGG - Intergenic
1046661573 8:116953015-116953037 AAGGGGAGAGAAAGGGAGGGAGG - Intronic
1047164641 8:122423600-122423622 GAGAGCAGAGAGAGGGAGTAGGG - Intergenic
1047518668 8:125577712-125577734 AAGAAGAGACAGAGGGAGGGAGG - Intergenic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047550237 8:125863654-125863676 AAGGGGAGACGGAGTAAGGAGGG - Intergenic
1047583598 8:126244019-126244041 AAGGGGAGAAAGAGGAATTGGGG + Intergenic
1048186298 8:132244365-132244387 AAAGAGAGACAGAGAGAGAAAGG + Intronic
1048234311 8:132675218-132675240 AAGGGGAGGAAGAGGCAGAAAGG - Intronic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048802899 8:138210563-138210585 CAGAAGAGACAGAGAGAGTAAGG + Intronic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1049721864 8:144120546-144120568 AACGGGACACAGAGTGAGTAGGG + Intergenic
1050002816 9:1096708-1096730 AGGGGGAGACAGAGGAAAGAAGG + Intergenic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050182873 9:2939075-2939097 GAGGGGAGACAGAGTGAGAGAGG + Intergenic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1050579724 9:7040302-7040324 AAAGAGAGACAGAGGGAGGGAGG - Intronic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1050840619 9:10143900-10143922 GAGGGGAGAGGGAGGAAGTAGGG + Intronic
1051049591 9:12915355-12915377 AAGGGAAGGCAGAGGAATTATGG - Intergenic
1051581005 9:18674458-18674480 AAGGAGAGAGAGAGGGATAAAGG - Intronic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1052301147 9:26953996-26954018 AAAGGGAGAATGAGGGAGTAGGG - Intronic
1053049321 9:34945669-34945691 TACAGGAGACAGAGGGAGGAAGG - Intergenic
1053225435 9:36351636-36351658 ACGGGGAGAGAGAGGAAGGAAGG + Intronic
1053480761 9:38414754-38414776 ATGGGGAGGCAGAGGGAGTGGGG - Intronic
1053525511 9:38826230-38826252 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1053580537 9:39399438-39399460 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1053817456 9:41927528-41927550 AAGGAGAGAAAGAGGGAGGGAGG + Intronic
1054102124 9:60958243-60958265 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054197740 9:62050657-62050679 GAGGGGAGCCAGAGGGGGGATGG - Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054584235 9:66948620-66948642 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1054640614 9:67537715-67537737 GAGGGGAGCCAGAGGGGGGATGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055264621 9:74480818-74480840 AGGGGGAGAGAGAGAGAGAAAGG - Intergenic
1055677775 9:78682798-78682820 AAGGGGAGGAAGAGAGAGGAAGG - Intergenic
1055730271 9:79273801-79273823 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
1056321091 9:85435143-85435165 AAGGGAAGCCAGAGAGAGAAAGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056545111 9:87606659-87606681 ACAGGGAGAGAGAGGGAGGAAGG - Intronic
1056545124 9:87606706-87606728 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1056604943 9:88077853-88077875 AGAGGGAGACAGAGGGAGCGGGG + Intergenic
1057195905 9:93115575-93115597 GAGGGGTGAGAGAGGGAGTGAGG + Intergenic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1057470686 9:95353598-95353620 AAGGAGAGAAAGAGGAAGGAAGG - Intergenic
1057489957 9:95512788-95512810 AAGGGGTGCCAGAGGCAGAAGGG - Intronic
1057565052 9:96160100-96160122 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1057936606 9:99244905-99244927 AAGGGGAGAAGGAGAGAGAAGGG + Intergenic
1058046484 9:100363145-100363167 ACGCGGCAACAGAGGGAGTAAGG - Intergenic
1058075344 9:100644917-100644939 AGGGAGGGACAGAGGGAGCAAGG - Intergenic
1058201591 9:102048936-102048958 AAGGGAAGAGAGAGAGAGAAAGG + Intergenic
1058314524 9:103548312-103548334 AGAGGGAGAGAGAGGGAGGAAGG + Intergenic
1058368466 9:104236063-104236085 AAGGGGAGAGGGAGGGAGAGAGG + Intergenic
1058561863 9:106238872-106238894 AAGGAGCAACAGAGGAAGTAAGG - Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058726009 9:107804860-107804882 TAGGAGAGACAGTGGAAGTAAGG + Intergenic
1059139132 9:111835451-111835473 AATGGGATACAGAGGAACTAGGG - Intergenic
1059161811 9:112041765-112041787 GAGGGGAGTCAAAGGGAGTGTGG - Intronic
1059410085 9:114126436-114126458 AAGAGGAGAGGGAGGGAGGAAGG - Intergenic
1059701923 9:116783341-116783363 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1059750734 9:117244793-117244815 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1059770238 9:117416955-117416977 AAGGAGAGACTGAGGGAGGCAGG - Intergenic
1059814074 9:117892072-117892094 AAGAGGAGAAAGAGGCAGGATGG - Intergenic
1059929861 9:119249951-119249973 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059929886 9:119250039-119250061 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1060060214 9:120453244-120453266 GAAGAGAGACAGAGGGAGTGAGG + Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060592701 9:124828960-124828982 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060592713 9:124829028-124829050 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060834707 9:126746267-126746289 AAGAGGAGACAGAGTGAGTGTGG - Intergenic
1061013378 9:127968233-127968255 AAGGGGAGAGAGAGGAGGAACGG + Intronic
1061492108 9:130951074-130951096 AGGGGGAGACAGGGAGAGGAAGG - Intergenic
1061916205 9:133755732-133755754 AGGGGGAGAGAGAGGGAGACAGG + Intergenic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144060 9:134979105-134979127 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1062145852 9:134989288-134989310 GAGGGGAGACTGAGGAAGTGGGG + Intergenic
1062275158 9:135727052-135727074 AATGGGAAACAGAGGGAGAGAGG - Intronic
1062275196 9:135727168-135727190 AAAGAGAGAGAGAGGGAGAAAGG - Intronic
1062687466 9:137822084-137822106 CAGGGGAGAAGGAGGGACTAAGG - Intronic
1203687531 Un_GL000214v1:9366-9388 AGGGGGAGAAACAGGGATTAAGG + Intergenic
1203714475 Un_KI270742v1:130931-130953 AGGGGGAGAAACAGGGATTACGG - Intergenic
1203536731 Un_KI270743v1:47153-47175 AGGGGGAGAAACAGGGATTACGG + Intergenic
1203648744 Un_KI270751v1:94687-94709 AGGGGGAGAAACAGGGATTAAGG - Intergenic
1203654449 Un_KI270752v1:9595-9617 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1185478023 X:426581-426603 AAGGAGAGACAGAGGCAATTTGG - Intergenic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185550083 X:976007-976029 AAGAGGAGGCAGAGAGAGAAGGG + Intergenic
1185637182 X:1561349-1561371 AAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1185679102 X:1873686-1873708 AAGGAGAGAGAGAGGGAGTGGGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185708473 X:2282685-2282707 GAGGGGAGAAAGAGGGAGAGAGG + Intronic
1185708502 X:2282819-2282841 AGAGGGAGAGAGAGGGAGAAAGG + Intronic
1185751157 X:2610407-2610429 GAGGGGAGAGAGAGGGAGAGAGG - Intergenic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1185884039 X:3766190-3766212 AGGGGGAGAGAGGGGGAGCAAGG - Intergenic
1186001954 X:5022427-5022449 AGGGGGAGACACAGAGAGGAGGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186309036 X:8297192-8297214 AAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1186369031 X:8927698-8927720 GAGGAGAGAGAGAGGGAGAAAGG - Intergenic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1187283764 X:17883173-17883195 AAGGGTAGAAGAAGGGAGTAAGG + Intergenic
1187319590 X:18227755-18227777 AAGGGGAGACAGGCTGAGCATGG + Intergenic
1187575328 X:20547784-20547806 CTGGGGAGAGAGAGGGAGTGAGG + Intergenic
1187696143 X:21923037-21923059 AAGGAGAGAAAGAGAGAGAAAGG + Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188450193 X:30301050-30301072 AAGGAGGGAGAGAGGAAGTAAGG + Intergenic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1189217312 X:39337364-39337386 AGGGAGAGAGAGAGGGAGAAAGG - Intergenic
1189224113 X:39398360-39398382 AGAGGGAGAAAGAGGGAGAAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189675518 X:43456933-43456955 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190022457 X:46891521-46891543 AAGGGGAAACAAGGGGAGTGGGG + Intronic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190325498 X:49204789-49204811 AAGGGGAGAGAGCGGGTGTGAGG - Intergenic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1191149406 X:57204787-57204809 AAGGGGAGAAAAAAGGACTATGG - Intergenic
1191915568 X:66198155-66198177 AAAGGGAGAGAGAGGGAGGGAGG - Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192528488 X:71867742-71867764 AGGGAGACACAGAGAGAGTATGG + Intergenic
1193198757 X:78663267-78663289 ATGGGGAGAAAGAGAGGGTAGGG + Intergenic
1193508363 X:82370635-82370657 AAGGGGAGAGAGAGGGAGAGGGG + Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194895455 X:99433941-99433963 CAGGGGAGACAGAACGAGTGTGG + Intergenic
1194936152 X:99951517-99951539 AAGGAAAGAGAGAGGGAGTAAGG - Intergenic
1194988117 X:100513257-100513279 AAAGGGAGGGAGAGGGAGCAAGG - Intergenic
1195385884 X:104313290-104313312 AGGGGGACAAAGAGGGAGGAAGG - Intergenic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195565151 X:106331755-106331777 AGGGCCAGACAGAGGAAGTATGG + Intergenic
1195640925 X:107174106-107174128 AGGGGGAGAGAGAGGGAGGGAGG - Intronic
1195662261 X:107391303-107391325 AGGGGCAGAGAGAGGGGGTAAGG - Intergenic
1195746617 X:108124920-108124942 AAGGGAACACAGAGAAAGTAGGG - Intronic
1195966613 X:110435025-110435047 AGGGAGGGACAGAGGGAGAAAGG + Intronic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1196460724 X:115926842-115926864 AAGGTGAGGGAGTGGGAGTAGGG + Intergenic
1196551287 X:117028856-117028878 AAGGTGAGACGGTGGGAGTGAGG - Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1196706436 X:118721364-118721386 AAGGGGAGCAAGAGAGCGTAGGG + Intergenic
1196769585 X:119280686-119280708 AGGGGGAGAGAGAGAGAGAAAGG - Intergenic
1196797709 X:119515555-119515577 AGGGGGAGAGAGAGGGAGGGAGG + Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197829003 X:130621474-130621496 AATGGGACACAAAAGGAGTATGG - Intergenic
1198108971 X:133485800-133485822 AAGGGGAAACTGAGGGGGCAGGG + Intergenic
1198116491 X:133549740-133549762 AAAGAGAGAGAGAGGGAGGATGG - Intronic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198301076 X:135334629-135334651 AAGTGGAGTGAGAGAGAGTAGGG - Intronic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1198381622 X:136089169-136089191 AATGAGAGACAGAGGGAACAAGG + Intergenic
1198480353 X:137034575-137034597 AGGGGGAGAAAGAGGGAGAGAGG - Intergenic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199924899 X:152451732-152451754 TAAGGGAGACAGAGGGAAAAAGG - Intergenic
1199966286 X:152823686-152823708 AAGGGGAGGAAGAGGGAGCAGGG - Intergenic
1201075244 Y:10181826-10181848 TAGGGGAGAAAGAGAGAGAAGGG + Intergenic
1201441421 Y:14012769-14012791 AAGGGGTGACAGAGGGCACATGG + Intergenic
1201443149 Y:14029938-14029960 AAGGGGTGACAGAGGGCACATGG - Intergenic
1201550337 Y:15211591-15211613 AAGGTGAGAGAGAGGGAGGGAGG + Intergenic
1201691719 Y:16774753-16774775 AAGGGTAGAGAGAGGTAGCAAGG - Intergenic
1201741219 Y:17326096-17326118 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202233524 Y:22681815-22681837 AAGGAGGGACAGAGGGAGAGGGG - Intergenic
1202309632 Y:23514343-23514365 AAGGAGGGACAGAGGGAGAGGGG + Intergenic
1202561169 Y:26156249-26156271 AAGGAGGGACAGAGGGAGAGGGG - Intergenic