ID: 901804027

View in Genome Browser
Species Human (GRCh38)
Location 1:11726486-11726508
Sequence TTGGCTCGGAAGGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901804027_901804034 8 Left 901804027 1:11726486-11726508 CCAGCAGCTTCCTTCCGAGCCAA 0: 1
1: 0
2: 0
3: 19
4: 149
Right 901804034 1:11726517-11726539 AGTGCAGAGAAGAGCAGAAGCGG 0: 1
1: 0
2: 9
3: 72
4: 678
901804027_901804036 30 Left 901804027 1:11726486-11726508 CCAGCAGCTTCCTTCCGAGCCAA 0: 1
1: 0
2: 0
3: 19
4: 149
Right 901804036 1:11726539-11726561 GGACTCCTGCAAGATAAGAAAGG 0: 1
1: 0
2: 2
3: 10
4: 191
901804027_901804035 9 Left 901804027 1:11726486-11726508 CCAGCAGCTTCCTTCCGAGCCAA 0: 1
1: 0
2: 0
3: 19
4: 149
Right 901804035 1:11726518-11726540 GTGCAGAGAAGAGCAGAAGCGGG 0: 1
1: 0
2: 4
3: 58
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901804027 Original CRISPR TTGGCTCGGAAGGAAGCTGC TGG (reversed) Intergenic
900478249 1:2886220-2886242 TTGGCTTGGATGGAGGCTGCGGG + Intergenic
900799147 1:4726913-4726935 TTGGCCCAGAGGGAAGCTGAGGG + Intronic
901804027 1:11726486-11726508 TTGGCTCGGAAGGAAGCTGCTGG - Intergenic
906639864 1:47435209-47435231 CTGGCAAGGAAGGAAGCTACTGG + Intergenic
913542603 1:119836198-119836220 CTGGCTCATCAGGAAGCTGCAGG - Intergenic
913989592 1:143598504-143598526 TAGGCTCAGCAGGGAGCTGCTGG - Intergenic
916445194 1:164865361-164865383 CTGGTTCGGGTGGAAGCTGCAGG - Intronic
919840918 1:201608903-201608925 TTGGCTCTGAGGGAGGCTGCTGG + Intergenic
920266954 1:204731060-204731082 TTGGCTCGGCTGGAAGGTGAAGG - Intergenic
920302702 1:204998636-204998658 TTGGCTGAGGAGGAACCTGCTGG + Intronic
920528042 1:206683364-206683386 TAGACTCGGGAGGAAGCTGCTGG + Intronic
920533756 1:206723843-206723865 TTGCCTGGGAAGGAAGCTCTAGG - Intronic
921963290 1:221058913-221058935 ATGGCTGGGCAGGGAGCTGCTGG + Intergenic
1064631738 10:17321248-17321270 TTGGCCCTGAAGGAAAATGCTGG + Exonic
1065168167 10:23002198-23002220 TTGGCTTGGAAGGAACCACCTGG + Intronic
1070282726 10:75061700-75061722 TTGGCCCAGAATGCAGCTGCAGG + Intergenic
1070779019 10:79126875-79126897 TTGGCCCAGAAGGCTGCTGCTGG + Intronic
1070989545 10:80719354-80719376 ATGGCTTGGGAGGCAGCTGCTGG + Intergenic
1071559012 10:86631255-86631277 CTGGCTGAGAAGAAAGCTGCTGG - Intergenic
1077140618 11:1022633-1022655 CTGGCTGGGAGGGAAGCTCCAGG + Intronic
1077279207 11:1734479-1734501 TTCACTCGGAAGGAAGCAGCAGG - Exonic
1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG + Intergenic
1080966885 11:37224070-37224092 GTGGCTGGGCAGGAAGCTCCAGG + Intergenic
1084758465 11:71253113-71253135 TTGGCTTGGAGGGCAGCTGGCGG - Intergenic
1084981154 11:72829432-72829454 ATGGCGCCGAAGGAAGCTTCAGG - Exonic
1088105661 11:106204158-106204180 TTGGCCCTGAAGAAAGCTTCCGG + Intergenic
1089010037 11:115124660-115124682 TAGGCGCCAAAGGAAGCTGCTGG - Intergenic
1089531204 11:119130976-119130998 TTGGGGTGGAAGGAAGCTGGGGG + Intronic
1090498103 11:127234288-127234310 GGGGCTGGGTAGGAAGCTGCTGG + Intergenic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1096570697 12:52521499-52521521 TTGGCCCTGAAGGAGGCTGTGGG - Intergenic
1096781186 12:53993161-53993183 TTGACTCCCAAGGAAGCTGGAGG + Intronic
1096980355 12:55725098-55725120 TTGGCCAGGAAGGGAGGTGCTGG + Intergenic
1103713503 12:122929819-122929841 TGGGCTCGGAGGGCAGCTGGGGG + Exonic
1104477255 12:129081089-129081111 GTGGCTCAGCAGGAAGTTGCTGG + Intronic
1104625932 12:130354680-130354702 TTTACTCGGAAGGAAGCCACTGG + Intronic
1104806444 12:131592324-131592346 TTGGCTGGGAAAGAATCTTCCGG - Intergenic
1105602947 13:21903137-21903159 TTGGTTCAGAAGGGAGGTGCAGG + Intergenic
1105617777 13:22035657-22035679 CTGGGTGGGAAGGAAGCTGGTGG - Intergenic
1106953164 13:34906847-34906869 TTGGCTCCAGAGGAAGCTGAAGG + Intergenic
1106998206 13:35512874-35512896 TTCTCTCAGAAGGCAGCTGCAGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120993466 14:90397860-90397882 TGGGCTGGGAAGGAAGGAGCCGG + Intronic
1121982133 14:98463837-98463859 TTGGGTCGGCAGCAAGCTTCTGG - Intergenic
1122534035 14:102449766-102449788 TTGGCTGGCACTGAAGCTGCTGG - Exonic
1122889607 14:104726192-104726214 CTGGCTCGTGAGGAGGCTGCAGG - Intronic
1122961500 14:105096029-105096051 TTGGGGCAGAAGGAAGGTGCAGG + Intergenic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1126861758 15:52891155-52891177 TTGGCTGGGGAGGATGCTGGAGG + Intergenic
1127992914 15:64133880-64133902 TTTCCAGGGAAGGAAGCTGCTGG - Intronic
1132902261 16:2263578-2263600 CAGGCTGGGAAGGCAGCTGCTGG + Intronic
1135998834 16:27274175-27274197 TTGGCTAGAGAGGAAGCTTCGGG + Intronic
1137765185 16:50972564-50972586 TTTGCTTGGAAGGATGCTCCAGG + Intergenic
1137801458 16:51265913-51265935 TTGGCCCAGAAGGAAGCTGAGGG - Intergenic
1142592192 17:1011152-1011174 TCCAGTCGGAAGGAAGCTGCAGG - Intronic
1143182017 17:4989287-4989309 GTTGCTTGGAAGGAAGCTGTGGG - Intronic
1145253760 17:21311496-21311518 TTGTCTAGGAGGGAAACTGCTGG + Intronic
1145322828 17:21776465-21776487 TTGTCTAGGAGGGAAACTGCTGG - Intergenic
1146136517 17:30326171-30326193 TCAGATAGGAAGGAAGCTGCTGG + Intronic
1148747770 17:49927932-49927954 TTTCCTTGGAAGGAAGCTGCGGG + Intergenic
1152702311 17:81825184-81825206 GTGGCCCTGGAGGAAGCTGCTGG + Exonic
1154170218 18:12046152-12046174 TTGGGTGGGTAGGAAGCTTCAGG - Intergenic
1154172605 18:12062095-12062117 TTGGGTGGGTAGGAAGCTTCGGG + Intergenic
1157043307 18:44064723-44064745 TTGACTGGCATGGAAGCTGCTGG + Intergenic
1161932241 19:7348862-7348884 TTGGTTCCACAGGAAGCTGCTGG + Intergenic
1162481545 19:10929522-10929544 TGGTCTCGGAATGCAGCTGCTGG - Exonic
1164571211 19:29375792-29375814 TTGGCTGGGATGGAAGCCACTGG + Intergenic
1165441890 19:35833209-35833231 TTGGCTGGGATGGAAGTTGGTGG - Intronic
1168214047 19:54912240-54912262 TAGGCTCTGAAGGAAGGGGCTGG + Intronic
925054164 2:843251-843273 GCTGCTCCGAAGGAAGCTGCTGG + Intergenic
925058470 2:873215-873237 TCAGGTGGGAAGGAAGCTGCCGG - Intergenic
925140388 2:1546233-1546255 TTTGAGCGGAAGGAAGATGCAGG - Intergenic
926691148 2:15734686-15734708 ATGGCTGGGAAAGAAGTTGCTGG + Intronic
927403759 2:22744357-22744379 TTGGTTGCTAAGGAAGCTGCAGG + Intergenic
928084312 2:28336290-28336312 CTGGTTCGGAAGGAAACTGAAGG + Intronic
929116308 2:38447334-38447356 TTGGCTCTGCAGGAAGCTTCTGG + Intergenic
931747246 2:65301047-65301069 TTGGCGGGGAAGGAAGCAGTGGG - Intergenic
933721728 2:85401478-85401500 CTGGCTCTGAGGGAAGCTGCAGG + Intronic
936115946 2:109703184-109703206 TTGGCTGGACAGGAAACTGCTGG + Intergenic
937888125 2:126914429-126914451 GTGCCTCGCAAGGAAGCTGTGGG - Intergenic
940883622 2:158969640-158969662 CTGGCTGGGAAGGAAGCTCTAGG + Intronic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
946263567 2:218518892-218518914 TTGGCTTAGAAGGAAACTCCCGG - Intronic
946778160 2:223165541-223165563 TTGGTATTGAAGGAAGCTGCAGG - Intronic
947932597 2:233975995-233976017 TTGGCCTGGATGGAAGCTGCAGG + Intronic
1169260459 20:4134619-4134641 TGGGCTGGGAAGGAAGGAGCTGG + Intronic
1169571899 20:6915314-6915336 CTGGCTGGGAAGAAATCTGCGGG + Intergenic
1173553214 20:43947852-43947874 CTGGCTGGGAAGGAAGGTGCTGG + Intronic
1175245907 20:57581779-57581801 TTGTCTGGGAAGGAAGCTCTGGG + Intergenic
1175484370 20:59334722-59334744 TTGGCTCACAAGGAAGCTTCTGG + Intergenic
1176049612 20:63110944-63110966 TTGGCTGGGAGGAAAGCTCCAGG + Intergenic
1177576263 21:22960128-22960150 TTGGCTCTGAAGAATGCTGTGGG + Intergenic
1180966726 22:19792642-19792664 TGGGCTGAGAAGAAAGCTGCTGG + Intronic
1181520719 22:23448103-23448125 CTGTCTCGGCCGGAAGCTGCCGG + Intergenic
1182420700 22:30247229-30247251 TTGGCTGAGAAGGAGGCTCCAGG + Intergenic
1182685455 22:32119640-32119662 TGGGCTGGGTAGGAAGCTGCGGG - Intergenic
1183900612 22:41003170-41003192 TTGGTTGGGAAGGAAGGAGCTGG - Intergenic
955452049 3:59078970-59078992 TTGGCTTTGAAGGATGCTGGTGG + Intergenic
955476161 3:59338493-59338515 ATGTCTGGGAAGGAGGCTGCAGG - Intergenic
956242076 3:67141955-67141977 TTGGCTCTGAAGACAGCAGCAGG - Intergenic
956711630 3:72043317-72043339 TTGCCTCAGGAGGAAGTTGCAGG + Intergenic
957549703 3:81687987-81688009 TTGGTGTGGAATGAAGCTGCTGG - Intronic
959452412 3:106519932-106519954 TTGGTTGGCAAGGAACCTGCTGG + Intergenic
959616474 3:108353859-108353881 TTGACTTGGAAGGAAGCTCATGG - Intronic
960357473 3:116671291-116671313 TTGTCTCTAGAGGAAGCTGCTGG + Intronic
960611032 3:119554820-119554842 TTGGATCAGAAGGAAGTTGATGG - Intronic
964327570 3:155563806-155563828 TAGGCTAGGAAGGGAGCTGAGGG - Intronic
966802433 3:183776631-183776653 TTGGCTTGGCAGGAAGATCCTGG - Intronic
967699751 3:192577965-192577987 TTGGCTCCAAAGAAAGGTGCAGG + Intronic
968958576 4:3731137-3731159 TTCACTCTTAAGGAAGCTGCTGG + Intergenic
969059956 4:4426565-4426587 CTGGGTGGGAAGGAGGCTGCTGG - Intronic
972001047 4:34033854-34033876 TTGGCTTGTAAGGGAGCTGTGGG - Intergenic
973986221 4:56356481-56356503 TGGGCTGAGAAGAAAGCTGCTGG + Intronic
975026710 4:69557899-69557921 GTGTCTCGGAAGAAACCTGCTGG - Intergenic
978436418 4:108689793-108689815 TTGGCTAGGAAAAAAGCTGGGGG - Intergenic
984533972 4:180949970-180949992 GTGGCTGGGAAGAAAGCTGCTGG - Intergenic
985147378 4:186907045-186907067 TTGGCTTGGAAGAAAGGTGTGGG - Intergenic
985234025 4:187852911-187852933 TTGGAGCTGAAGGAAGCTGTGGG - Intergenic
991025857 5:62028912-62028934 GGGGCTGTGAAGGAAGCTGCAGG - Intergenic
993494612 5:88593767-88593789 TTGGCTAGGAAAGCAGCTACTGG - Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994589653 5:101758032-101758054 TGGGGTCCGAAGGAAGCTGCTGG + Intergenic
995190892 5:109318331-109318353 TTGGCTGGCTAGGAACCTGCAGG - Intergenic
998554979 5:143114537-143114559 TTAGCTGGAAATGAAGCTGCTGG - Intronic
998618746 5:143771336-143771358 TTGGCTCAGAAAGCAGCAGCAGG + Intergenic
1000234660 5:159346210-159346232 TTGGCTGGGAAGCTAGCTGCTGG + Intergenic
1001340439 5:170838679-170838701 ATGGCTTGGAATGAAGCTTCTGG + Intergenic
1002181201 5:177431969-177431991 TTGGCAGTGATGGAAGCTGCTGG - Intronic
1002419048 5:179136039-179136061 TTGGCTGGAAGGGAAGCAGCTGG + Exonic
1003840958 6:10118800-10118822 TGGGCTGAGAAGAAAGCTGCTGG + Intronic
1005421494 6:25655888-25655910 TTGGCTGGGAAGAAAGCTTTTGG + Intronic
1006372248 6:33652308-33652330 TTGGCTCAGCATGAATCTGCCGG - Intronic
1008604634 6:53128481-53128503 GTGGCTCCAATGGAAGCTGCTGG + Exonic
1017041952 6:150315096-150315118 TTTCCTTGGAAGGAAGCTGAAGG - Intergenic
1018742686 6:166742633-166742655 GTTGCTGGGAAGGATGCTGCAGG - Intronic
1019362664 7:613505-613527 TTGGCTGTGAACGGAGCTGCTGG - Intronic
1019475964 7:1244354-1244376 TTCGCTCTGAAGGCAGCGGCTGG - Intergenic
1019590521 7:1828144-1828166 CTGTCTCGGCCGGAAGCTGCCGG - Intronic
1022610025 7:31861706-31861728 TGGACTAGGAAGGATGCTGCTGG - Intronic
1022941860 7:35249385-35249407 TTGGCCAGGCAGGAAGCTGCAGG - Intronic
1023555736 7:41421076-41421098 CTGGCTCAGAAGCAAACTGCGGG - Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1029005092 7:97201118-97201140 TGGGCTAAGAAGAAAGCTGCTGG - Intergenic
1035203346 7:157280003-157280025 TTGGCTGAGAAAGGAGCTGCCGG + Intergenic
1035630739 8:1104898-1104920 TCTGCTAAGAAGGAAGCTGCCGG - Intergenic
1037418487 8:18676790-18676812 CTGGCTCTGCAGGAAGCAGCAGG - Intronic
1037635649 8:20699481-20699503 TTGGCTAGGAAGGTAGCTCCTGG - Intergenic
1039065144 8:33601107-33601129 TTGGCTCAGATTGAAGCTGATGG + Intergenic
1039880964 8:41625419-41625441 TTGGCCAGGAAGGAAGCTAAAGG - Intergenic
1040609787 8:48972809-48972831 ATGGCTTGGAAGGAATGTGCAGG - Intergenic
1040943098 8:52852785-52852807 TAGGCACGGAAGGAATCTCCTGG + Intergenic
1041414389 8:57591512-57591534 TTGGCTCTGAAGCTTGCTGCTGG - Intergenic
1049059976 8:140269000-140269022 TTGGCTGGGAAGGAACATGTGGG + Intronic
1049844305 8:144792593-144792615 TGGGCTCGGAAGGAGGGTGCAGG + Intergenic
1061870087 9:133515821-133515843 ATGGCTGGGAAGGAAGCCACTGG + Intronic
1062456476 9:136641743-136641765 TGAGCTCGGGAGGAGGCTGCAGG - Intergenic
1185819891 X:3192336-3192358 TTTGCTCTGGAGGAATCTGCTGG + Intergenic
1186075385 X:5873017-5873039 CTGGCTGGGAAGGGAGATGCAGG - Intronic
1187662099 X:21560045-21560067 TGGGCAAGGAGGGAAGCTGCAGG + Intronic
1189189681 X:39089407-39089429 CTGGCTCTGAAGAAAGCAGCAGG + Intergenic
1190265235 X:48824101-48824123 TTGGCCCGGGAGCAAACTGCAGG + Intronic
1192149305 X:68702059-68702081 TTGCCTCCGAAGCAAGCTCCAGG + Intronic
1192810996 X:74547355-74547377 TTGGCTGGGCAGGAAGCAGCAGG - Intergenic
1193149975 X:78114901-78114923 TTGACTAGAAAGGAAGCTGAAGG + Intronic
1194150132 X:90314918-90314940 TTGGTTCTGAAGAAAGCTGAAGG + Intergenic
1201898309 Y:19018003-19018025 ATGGCTTTGAAGGAAGCTGGGGG - Intergenic
1202258672 Y:22946459-22946481 TGGGCTAGGAAGTAAGCTGTGGG - Intergenic
1202411661 Y:24580217-24580239 TGGGCTAGGAAGTAAGCTGTGGG - Intergenic
1202459121 Y:25089855-25089877 TGGGCTAGGAAGTAAGCTGTGGG + Intergenic