ID: 901804643

View in Genome Browser
Species Human (GRCh38)
Location 1:11730573-11730595
Sequence CCTGGACTCCAACAGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901804633_901804643 27 Left 901804633 1:11730523-11730545 CCTCTTACTTCCGCTTGTGTTCT No data
Right 901804643 1:11730573-11730595 CCTGGACTCCAACAGGGCACAGG No data
901804637_901804643 17 Left 901804637 1:11730533-11730555 CCGCTTGTGTTCTGGGTGGTTTC No data
Right 901804643 1:11730573-11730595 CCTGGACTCCAACAGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901804643 Original CRISPR CCTGGACTCCAACAGGGCAC AGG Intergenic
No off target data available for this crispr