ID: 901807896

View in Genome Browser
Species Human (GRCh38)
Location 1:11749483-11749505
Sequence ACATCCTTTGGGACTTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901807889_901807896 7 Left 901807889 1:11749453-11749475 CCCATTGGACAGATGAGGAAACT 0: 2
1: 96
2: 1162
3: 4727
4: 10843
Right 901807896 1:11749483-11749505 ACATCCTTTGGGACTTGTTCAGG 0: 1
1: 0
2: 2
3: 7
4: 109
901807887_901807896 20 Left 901807887 1:11749440-11749462 CCAGAATGTTTCTCCCATTGGAC 0: 2
1: 0
2: 0
3: 5
4: 117
Right 901807896 1:11749483-11749505 ACATCCTTTGGGACTTGTTCAGG 0: 1
1: 0
2: 2
3: 7
4: 109
901807890_901807896 6 Left 901807890 1:11749454-11749476 CCATTGGACAGATGAGGAAACTG 0: 5
1: 125
2: 1492
3: 5479
4: 12271
Right 901807896 1:11749483-11749505 ACATCCTTTGGGACTTGTTCAGG 0: 1
1: 0
2: 2
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901807896 Original CRISPR ACATCCTTTGGGACTTGTTC AGG Intronic