ID: 901807943

View in Genome Browser
Species Human (GRCh38)
Location 1:11749652-11749674
Sequence GAGAGGAGTGCGTGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901807935_901807943 0 Left 901807935 1:11749629-11749651 CCTTGTACCTGGGAGGGGAGCTG 0: 1
1: 0
2: 6
3: 30
4: 274
Right 901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 329
901807938_901807943 -7 Left 901807938 1:11749636-11749658 CCTGGGAGGGGAGCTGGAGAGGA 0: 1
1: 1
2: 4
3: 78
4: 701
Right 901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 329
901807929_901807943 25 Left 901807929 1:11749604-11749626 CCATCTGGATATGGTAATGTGGT 0: 1
1: 0
2: 1
3: 17
4: 123
Right 901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG 0: 1
1: 1
2: 1
3: 26
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901807943 Original CRISPR GAGAGGAGTGCGTGGGCCCG GGG Intronic
900106382 1:982992-983014 CAGAGCACGGCGTGGGCCCGAGG - Intergenic
900269995 1:1782183-1782205 GAGAGTAGTGGGAGGGGCCGAGG + Intergenic
900376823 1:2358761-2358783 AAGCGGGGTGCGCGGGCCCGGGG + Intronic
900429020 1:2593295-2593317 GAGAGGAGTACGTGGTCCCTGGG + Intronic
901135626 1:6992159-6992181 GAGAGGATTGCTTGAGCCCCAGG - Intronic
901792063 1:11658865-11658887 GAGGGAGGTGCGTGGGCCTGGGG + Exonic
901807943 1:11749652-11749674 GAGAGGAGTGCGTGGGCCCGGGG + Intronic
901808979 1:11755153-11755175 GAGAGGAGTGCGTGGGCCTGGGG + Intergenic
902767492 1:18627206-18627228 GAGAGGAGGGGGTGGGCGTGGGG - Intergenic
902922818 1:19677373-19677395 GAAAGGAAGGCATGGGCCCGGGG - Intronic
903791383 1:25895525-25895547 GACAGAAGTGGGTGGGCCCAAGG + Intronic
903942823 1:26943297-26943319 GAGAGAATTGCTTGGGCCCAAGG - Intronic
905814140 1:40935208-40935230 GAGAGGATTGCTTGAGCCCAAGG + Intergenic
906444869 1:45887554-45887576 GGGAGGAGTTCCTGGGCCCCAGG + Intronic
906483430 1:46216431-46216453 GAGAGGATTGCTTGAGCCTGGGG - Intronic
906511835 1:46414415-46414437 GAGAGGAGCCCATGGGCCTGGGG + Intergenic
906532090 1:46529800-46529822 GAGAGGACTGCTTGAGCCCAGGG + Intergenic
907024830 1:51106554-51106576 GAGAGGATTGCTTGAGCCCCAGG + Intronic
908233985 1:62132810-62132832 GGGAGGATTGCTTGAGCCCGGGG + Intronic
910757451 1:90707782-90707804 GAGAGGGGTGTGTGGGGCTGTGG - Intergenic
910841834 1:91568639-91568661 GAGAGGATTGCTTGAGCCTGGGG + Intergenic
911637938 1:100256482-100256504 GGGAGGATTGCGTGAGCCCCAGG + Intergenic
912320370 1:108707220-108707242 GGGAGGAGTGCTTGAGCCCAGGG - Intergenic
912935071 1:113996057-113996079 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
915238529 1:154502721-154502743 GAGCGGAGTGGGTGGGCGAGGGG - Intronic
917304390 1:173612150-173612172 GGGAGGATTGCTTGGGCCCAGGG + Intronic
917972290 1:180216656-180216678 GAGAGGAGTAAAAGGGCCCGAGG + Intergenic
918058714 1:181044551-181044573 GCGAGGAGTGCGTGAGGCTGAGG + Intronic
919861173 1:201740248-201740270 GAGAGGAGTGCCTGCGCCGCCGG + Intronic
919946967 1:202326638-202326660 GGGAGGATTGCTTGAGCCCGGGG - Intergenic
920198862 1:204247042-204247064 GGGAGGATTGCTTGAGCCCGGGG + Intronic
921112065 1:212048279-212048301 GAGAGGATTGCTTGAACCCGGGG - Intronic
921673225 1:217949442-217949464 GGGAGGATTGCTTGGGCCCAGGG + Intergenic
922736602 1:227986400-227986422 GGGAGGATTGCTTGGGCCCCAGG + Intergenic
923369307 1:233295100-233295122 GACAGGACTGCGGGGGCTCGGGG - Intronic
923646499 1:235826771-235826793 GAGAGGATTGCTTGAGCCTGGGG - Intronic
923992185 1:239451130-239451152 GGGAGGATTGCTTGAGCCCGGGG + Intronic
924485795 1:244482238-244482260 GAGAGGATTGCTTGAGCCCAGGG + Intronic
924636785 1:245795674-245795696 GACTGGAGCGCATGGGCCCGTGG - Intronic
1063160256 10:3413452-3413474 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1063706345 10:8434673-8434695 GAGAGGATTGCTTGAGCCCAGGG - Intergenic
1064327942 10:14368051-14368073 GAGAGGATTGCCTGAGCCTGGGG - Intronic
1067091244 10:43266738-43266760 GCGCGGCGTGCGCGGGCCCGGGG - Intronic
1067759110 10:49029955-49029977 GAGAGGGGTGCGGGGCCCCCTGG - Intronic
1068607846 10:59025905-59025927 AAGAGGAGGGCGTGGTCCCTGGG + Intergenic
1068977878 10:63031158-63031180 GAGAGGATTGCTTGAGCCCAGGG - Intergenic
1069778291 10:70939401-70939423 GAGAGGAGTGGGTGGTGCCTGGG + Intergenic
1070052201 10:72900228-72900250 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1070538212 10:77395118-77395140 GAGAGGATTGCCTGGGCCCAGGG + Intronic
1070782060 10:79143392-79143414 GAGAGGGGTGAGTGGGCCCGGGG - Intronic
1071534870 10:86420105-86420127 GAGAGGATTGCTTGAGCCTGGGG + Intergenic
1072170013 10:92849209-92849231 GAGAAGAGAGCGTGGGCTGGAGG + Intronic
1073100709 10:101005093-101005115 GAGAGGACTGCTTGAGCCCAGGG - Intronic
1075441063 10:122479765-122479787 GAGAGGGGATCGTGGGCCCGAGG + Intronic
1077121344 11:910374-910396 GTGAGGAGTGTGTGAGCGCGCGG - Intronic
1077282281 11:1751159-1751181 GAGAGGGTTGCCTGGGCCCGAGG + Intronic
1077537016 11:3129287-3129309 GTGAGGAGGGCCTGGGCCCTGGG + Intronic
1078216220 11:9314305-9314327 CAGAAGGGTGAGTGGGCCCGGGG - Exonic
1080804132 11:35636331-35636353 GAGAGGAGGGGGTGGGCTGGGGG + Intergenic
1081597029 11:44466560-44466582 GAAAGCAGTGCGTGCCCCCGAGG + Intergenic
1081748032 11:45486678-45486700 GAAAGGATTGGGTGGGGCCGGGG + Intergenic
1082106698 11:48228910-48228932 GAGAGGAGTGGGTGGGAACCGGG + Intergenic
1082813966 11:57496169-57496191 GAGAGGAGGGGGCAGGCCCGTGG + Intronic
1083425468 11:62582327-62582349 GGGAGGATTGCTTGAGCCCGGGG + Intronic
1083589490 11:63884973-63884995 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1083692099 11:64415539-64415561 GGGAGGGGAGCGTGGGCCCAGGG + Intergenic
1084073167 11:66750929-66750951 GAGAGGACTGCTTGAGCCCAGGG - Intronic
1084188173 11:67486325-67486347 TAGAGGAGGGCGTGGTCCCTGGG - Intronic
1084285707 11:68129033-68129055 GAGAGGACAGCGTGAGCCCAAGG - Intergenic
1084487049 11:69454621-69454643 GAGAGGTGGGGGTGGGCCTGAGG - Intergenic
1084561991 11:69910451-69910473 GAGGGGAAGACGTGGGCCCGTGG - Intergenic
1085039494 11:73318408-73318430 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1088299808 11:108344910-108344932 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1088522268 11:110712474-110712496 GAGCGGAGGGGGCGGGCCCGAGG - Intronic
1088692605 11:112340620-112340642 GGGAGGACTGCTTGGGCCCAGGG + Intergenic
1090171562 11:124610502-124610524 GCAAGGAGTACGTGGGCCCAAGG - Intergenic
1090277795 11:125431911-125431933 CAGAGGAGTGGGAGGGCCTGAGG + Exonic
1090792388 11:130102610-130102632 GAGAGGACTGCCTGGTCCTGAGG + Intronic
1091473807 12:753044-753066 CAGAGGAGTGGGAGGGGCCGAGG - Exonic
1091663029 12:2398696-2398718 GAGAGGGGAGCGTGGGTCCAGGG + Intronic
1094206204 12:27843458-27843480 GAGAGGATCGCGTGAGCCGGGGG + Intergenic
1095802155 12:46280841-46280863 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1096471199 12:51877089-51877111 GAGAGGATTGCTTGATCCCGGGG + Intergenic
1099116525 12:78632536-78632558 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1102280537 12:111615357-111615379 GGGAGGATTGCTTGAGCCCGGGG - Intergenic
1103913937 12:124366596-124366618 GGGAGGATTGCGTGAGCCCAGGG - Intronic
1104895178 12:132160500-132160522 GGGTGGAGTGGGTGGGCTCGGGG + Intergenic
1106099078 13:26679098-26679120 GAGAGGACTGGGAGGGCCAGAGG - Intronic
1106160888 13:27200371-27200393 GAGAGGATTGCTTGAGCCTGGGG + Intergenic
1106776152 13:33011822-33011844 GGGAGGATTGCTTGAGCCCGAGG + Intergenic
1108620043 13:52173161-52173183 GAGAGGACTGCTTGGACCCTGGG + Intergenic
1108838513 13:54582087-54582109 GAGAGGATTGCCTGAGCCCAGGG - Intergenic
1110320226 13:74152790-74152812 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1111502372 13:89138632-89138654 GAGAGGATTGCTTGAGCCCAAGG - Intergenic
1112599922 13:100844913-100844935 GGGAGGATTGCTTGGGCCCAAGG + Intergenic
1113564603 13:111312069-111312091 GAGAGGATTGCTTGAGCCCTAGG + Intergenic
1113839282 13:113349645-113349667 GTGAGGACAGCGTGGTCCCGTGG + Intronic
1114418085 14:22557325-22557347 GAGAGGAGGGCCTGGGGCCTGGG + Intronic
1115441620 14:33442350-33442372 GGGAGGATTGCGTGAGCCCAGGG + Intronic
1116927892 14:50659752-50659774 GGGAGGATTGCTTGAGCCCGAGG + Intronic
1117403533 14:55379448-55379470 GGGAGGATTGCTTGGGCCTGGGG + Intronic
1117590975 14:57268425-57268447 GGGAGGGGTGCTTGGGGCCGAGG - Intronic
1118000521 14:61518902-61518924 GAGAGGATTGCTTGAGCCCAGGG - Intronic
1119315038 14:73686612-73686634 GAGAGGATTGCTTGAGCCCGGGG + Intronic
1119341547 14:73883294-73883316 GAGAGGATTGCTTGAGCCCATGG - Intronic
1119539161 14:75427793-75427815 GAGAGGAGCGCGAGCGGCCGCGG + Intronic
1121608823 14:95261741-95261763 GAGAGGAGCGGGTGGACCTGTGG - Intronic
1122145850 14:99688485-99688507 GGAAGGTGTGCGTGGGCCTGGGG - Intronic
1122176377 14:99923031-99923053 GAGAGGATTGCTTGGACCTGAGG - Intronic
1122727442 14:103767221-103767243 GAGAGGACTGCTTGAGCCCGGGG + Intronic
1122783956 14:104155451-104155473 GAGAGGGGAGCGTGAGGCCGAGG - Intronic
1123013970 14:105364786-105364808 GGGAGGACTGCTTGGGCCCAGGG - Intronic
1127588046 15:60397156-60397178 GAGAGAAGGGCGTGGCCCCGGGG - Intronic
1127800647 15:62474414-62474436 GAGAGGATTGCTTGAGCCTGGGG + Intronic
1128493935 15:68180190-68180212 GAGAGGATTGCTTGAGCCTGGGG - Intronic
1129914736 15:79258862-79258884 GAGAGAAGTTCTTGGGCCCTAGG + Intergenic
1130922990 15:88364655-88364677 GAGATGACTGCGTGGGCCCTTGG + Intergenic
1130928299 15:88401550-88401572 GAGAGGAGGGCGTTGGCACTGGG - Intergenic
1131740417 15:95384374-95384396 GAGAGGATTGCTTGAGCCCATGG + Intergenic
1131788489 15:95938521-95938543 CAGAGGGGTGCCTGGGCACGGGG + Intergenic
1132125034 15:99215652-99215674 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1132684294 16:1155845-1155867 GAGAGGAGGGCTGGGGCCAGCGG + Intronic
1132706651 16:1246812-1246834 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1132837224 16:1960043-1960065 GAGAGCAGTGCGGGGTCCTGGGG - Intronic
1133352307 16:5109542-5109564 GAGAGAATTGCTTGAGCCCGGGG - Intergenic
1133506041 16:6413388-6413410 GAGAGGACTGCTTGAGCCCAGGG - Intronic
1133694413 16:8247906-8247928 TGGAGGAGTGTGTGGGCACGTGG + Intergenic
1135309908 16:21397421-21397443 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1135354138 16:21755601-21755623 GAGAGGATTGCTTGAGCCCAGGG - Intronic
1135362802 16:21829522-21829544 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1135452627 16:22571742-22571764 GAGAGGATTGCTTGAGCCCAGGG - Intergenic
1136154682 16:28374819-28374841 GAGAGGACTCTGTGGCCCCGGGG - Intergenic
1136208410 16:28740439-28740461 GAGAGGACTCTGTGGCCCCGGGG + Intergenic
1136306653 16:29376545-29376567 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1136398591 16:30005899-30005921 GTGAGGAGCGCGGGGGCCTGGGG + Exonic
1136561902 16:31044085-31044107 GGGAGGATTGCTTGGGCCTGGGG + Intergenic
1137279493 16:46963607-46963629 GGGAGGATTGCTTGGGCCCAGGG + Intronic
1138525870 16:57606993-57607015 GAGAGGCCCGCGTGGGCCAGGGG - Intergenic
1139650282 16:68358936-68358958 GGGAGGTGTGCGGGGGCCTGGGG + Exonic
1141091781 16:81135357-81135379 GGGAGGACTGCCTGAGCCCGAGG - Intergenic
1141775158 16:86118013-86118035 GCGAGGAGTGCGTGGGGGTGCGG + Intergenic
1142394322 16:89822921-89822943 GAGAGGAGTGCAGGGCCCCAGGG - Intronic
1142429239 16:90017604-90017626 GAGAGGAGGCTGTGGGCCTGGGG + Intronic
1203086359 16_KI270728v1_random:1186597-1186619 GAGAGAAGTGGGGGGGGCCGGGG + Intergenic
1142763956 17:2055764-2055786 GGGAGGAGTGCGCCGGCCCCAGG - Intronic
1143216429 17:5228551-5228573 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1143628883 17:8125965-8125987 GAGGGGAGTGCGAGGGCGTGCGG - Intergenic
1144672618 17:17141527-17141549 GAGAGGAGGGCGAGGGCCCCGGG - Intronic
1145908519 17:28529257-28529279 GAGGGGAGTGAGAGGGCCCCTGG + Intronic
1147044318 17:37742456-37742478 GAAGGGAGTGCGTGTGCCCGAGG + Intronic
1147761063 17:42797790-42797812 GAGAGGTGTGCATGCGACCGTGG - Exonic
1148331839 17:46818141-46818163 AAGAGGAGTGGCTGGGCCCCAGG + Intronic
1148370925 17:47099679-47099701 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1148862251 17:50610571-50610593 GAGAGGAGAGCAGGGGACCGAGG - Intronic
1150242108 17:63642847-63642869 AAGAGGATTGCTTGAGCCCGGGG - Intronic
1151330125 17:73401738-73401760 GGGTGCAGTGCCTGGGCCCGTGG - Exonic
1151712960 17:75817292-75817314 GAGGGGAGGGAGTGGGCCCGTGG - Intronic
1152132313 17:78484826-78484848 GAGGGGAAGGCGTGGCCCCGGGG - Intronic
1152647741 17:81477579-81477601 GACAGGAGTGGCTGGGGCCGGGG - Intergenic
1153102506 18:1489449-1489471 GGGAGGATTGCTTGAGCCCGGGG - Intergenic
1153346410 18:4030828-4030850 GGGAGGATTGCTTGAGCCCGGGG + Intronic
1153808205 18:8729134-8729156 GAGAGGACTGCTTGAGCCCAAGG - Intronic
1154962437 18:21323193-21323215 GGGAGGATTGCTTGAGCCCGGGG + Intronic
1154991078 18:21599244-21599266 GGGAGGATTGCTTGGGGCCGGGG + Intronic
1156476771 18:37410436-37410458 GTGTGGAGTGGGTGGGCCGGGGG - Intronic
1157304220 18:46505407-46505429 GAGAGGATTGCTTGAGCCCCAGG - Intronic
1159971990 18:74666335-74666357 CAGAGAAGTGGGTGGGCCCGAGG + Intronic
1160123527 18:76150948-76150970 GAGAGGAGTGAGTGGGGGAGAGG + Intergenic
1160930300 19:1567126-1567148 GAGAGGGGCTCGAGGGCCCGGGG - Intronic
1160935513 19:1592755-1592777 GGGCGGAGGGCGGGGGCCCGCGG - Intronic
1162128206 19:8510804-8510826 GAGAGGGGGGCGGGGGCCCAAGG - Intronic
1162140028 19:8580288-8580310 GGCAGGAGTGTGTGGGCCCCAGG + Exonic
1162854378 19:13457157-13457179 GAGAGGATTGCTTGAGCCCCAGG + Intronic
1162963315 19:14141736-14141758 GAGAGGATTGCTTGAGCCCTGGG + Intergenic
1166167532 19:41002638-41002660 GAGAGAATTGCTTGAGCCCGGGG - Intronic
1166252317 19:41579638-41579660 GAAAGGAGTGAGAGGGGCCGAGG - Intronic
1166255685 19:41602583-41602605 GTGAGGAGTGCTTGAGCTCGGGG - Intronic
1166347677 19:42176659-42176681 GAGAGGTGTACGTGGGGGCGGGG - Intronic
1166809387 19:45506747-45506769 GCGGGGCGTGCGTGGGCCGGAGG + Intronic
1167013787 19:46826347-46826369 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1167124933 19:47543046-47543068 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1167352944 19:48987022-48987044 GAGAGTAGAGCCTGGGCCCTTGG + Intronic
1168652424 19:58100179-58100201 GGGAGGATTGCTTGAGCCCGGGG - Intronic
925201026 2:1967947-1967969 GGGAGCAGTGCAGGGGCCCGAGG - Intronic
926118089 2:10225830-10225852 GAGAGGAGTGAGAGAGGCCGTGG - Intergenic
926402068 2:12507465-12507487 GAGAGGCGGCTGTGGGCCCGGGG - Intergenic
926968045 2:18437743-18437765 GGGAGGATTGCTTGAGCCCGGGG - Intergenic
927095795 2:19746911-19746933 GTGATGAGGACGTGGGCCCGGGG - Intergenic
927619242 2:24634801-24634823 GGGAGGATTGCCTGGGCCCAGGG - Intronic
927790828 2:26008276-26008298 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
928322439 2:30294684-30294706 GAGAGGATTGCTTGAGCCCAGGG - Intronic
929230096 2:39550279-39550301 GAGAGGAGCGCTTGAGCCCTGGG + Intergenic
929242268 2:39665655-39665677 GAGAGGAGTGCGCGGGGTGGGGG + Intronic
929497800 2:42461595-42461617 GAGTGGAGAGTGTGGGGCCGGGG - Intronic
929549333 2:42879537-42879559 GAGAGGTGTGTGTGGGGTCGAGG + Intergenic
933893206 2:86789617-86789639 GTGAGGCGTGCGGGGGCCCGGGG - Intronic
933973030 2:87485644-87485666 GAGAGGATTGAAGGGGCCCGAGG + Intergenic
934768085 2:96891813-96891835 GACAGGAGTGAGAGGGCCTGGGG + Intronic
935010283 2:99128837-99128859 GAGAAGATTGCTTGGGCCTGGGG - Intronic
935335141 2:102008934-102008956 GAGAGGAGTGCTTGAACCCAGGG + Intronic
937841510 2:126528858-126528880 GGGAGGATTGCTTGGGCCTGGGG + Intergenic
938903516 2:135817985-135818007 GAGAGGAGTCCGTGGTCTCGTGG + Exonic
941772693 2:169361847-169361869 GGGAGGAGTGCTCTGGCCCGCGG + Intronic
943041676 2:182812028-182812050 GAGAGGATTGCTTGAGCCTGAGG - Intergenic
944694995 2:202192840-202192862 GGGAGGATTGCTTGGGCCCAGGG - Intronic
944755863 2:202760998-202761020 GAGAGAATTGCCTGAGCCCGGGG - Intronic
944806075 2:203282405-203282427 GGGAGGATTGCGTGAGCCCCAGG + Intronic
945067198 2:205957260-205957282 GGGAGGAGTGGGGGGGCCTGGGG + Intergenic
945084397 2:206116657-206116679 GGGAGGAGCGCCTGGGCCCAGGG + Intronic
946411872 2:219519432-219519454 CAGAGGAGGGTGTGGGCCAGAGG - Intronic
946585547 2:221183124-221183146 GAGAAGATTGCTTGGGCCCGGGG + Intergenic
948486795 2:238286504-238286526 GGGGGGAGTGCGTGGGCTGGGGG + Intronic
1168895285 20:1319749-1319771 TAGGGGTGTGAGTGGGCCCGGGG + Intronic
1168904138 20:1390676-1390698 GAGAGGAGTGGGTAGGCACTGGG - Intronic
1171179953 20:23084888-23084910 TGGATGAGTGTGTGGGCCCGGGG - Exonic
1171255918 20:23689008-23689030 GAGAGGAGGGTGAGAGCCCGAGG + Exonic
1171263266 20:23750905-23750927 GAGAGGAGGGTGAGAGCCCGAGG + Exonic
1171366612 20:24629190-24629212 CAGAGGAGTGTGTGGGCTCCTGG - Intronic
1173537362 20:43825790-43825812 GAGAGAACTGCGCGTGCCCGAGG - Intergenic
1173864847 20:46307390-46307412 GAGTGGACTGCGTGGGCGCGCGG - Intronic
1173930139 20:46811333-46811355 GGGCGGAGGGCGGGGGCCCGGGG - Intergenic
1173936132 20:46866591-46866613 GAGAAGATTGCTTGAGCCCGAGG - Intergenic
1175339959 20:58222335-58222357 TGGAAGAGTGCGTGGGCTCGGGG - Intronic
1175800467 20:61798343-61798365 GTGAGGAGTGTGGAGGCCCGTGG - Intronic
1175866814 20:62183075-62183097 GAGCGGGGAGCGTGGGCCTGGGG + Intronic
1175899437 20:62354254-62354276 GAGAGAAGGGCCTGGGCCTGGGG - Intronic
1175920023 20:62446330-62446352 GAGGGCAGGGCGGGGGCCCGGGG + Intergenic
1175946832 20:62562834-62562856 GAGAGAAGGGCCTGGGCCCCGGG + Intronic
1176305624 21:5121654-5121676 GAGGAGGGTGCGTGGGCCCGCGG - Intronic
1179627848 21:42658637-42658659 GAGAGGAGTCAGTGTGGCCGGGG - Intronic
1179851433 21:44140377-44140399 GAGGAGGGTGCGTGGGCCCGCGG + Intronic
1179959360 21:44759443-44759465 GATTGGAGAGCGTGGCCCCGAGG - Intergenic
1180285938 22:10744516-10744538 GAGAGGATTGCTTGAGCCCAAGG - Intergenic
1181385025 22:22538423-22538445 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1182358433 22:29733288-29733310 GAGAGAAGGGCTTGGGCCTGCGG + Intronic
1183410016 22:37649392-37649414 GGGAGGACTGCTTGGGCCCAGGG + Intronic
1183674602 22:39292354-39292376 GAGAGGGGTGCTTGGGCTTGTGG - Intergenic
1184911387 22:47536917-47536939 CAGAGGAGTGCCAGGGCCTGGGG - Intergenic
1185282994 22:49983636-49983658 GGGAGGAGGGGGCGGGCCCGGGG - Intergenic
1185335180 22:50268103-50268125 GCGCGGAGTGGGTAGGCCCGAGG - Intronic
950397984 3:12748842-12748864 GAGAGGACTGGGTGGTCCCTGGG - Intronic
951529720 3:23686954-23686976 GAAAGGAGTGCTTGGGCCAAAGG - Intergenic
954075057 3:48172075-48172097 GGGAGGAGTGCTTGAGCCCATGG + Intronic
954910980 3:54108889-54108911 GAGAGGATTGCTTGAGCCCTGGG + Intergenic
954955013 3:54511189-54511211 GAGAGGAGGGCTAGGGCCAGAGG - Intronic
955952647 3:64257710-64257732 GAGGGCAGTGGGTGGGCCAGAGG + Intronic
957096945 3:75785468-75785490 AAGAGGAACCCGTGGGCCCGGGG - Intronic
957420992 3:79969673-79969695 GAGAGGACTGCTTGAGCCCAAGG + Intergenic
957959116 3:87227130-87227152 GATAGGAGAGCGTGGGGCCACGG - Intergenic
958597864 3:96253132-96253154 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
960638903 3:119809343-119809365 GAGAGGGGTGTGCGGGCCCGTGG + Intronic
963159396 3:142135195-142135217 GAGAGGATTGCTTGAGCCCAGGG - Intronic
963894740 3:150673277-150673299 GAAAGGATTGCTTGAGCCCGAGG - Intronic
964681568 3:159345781-159345803 AAGAGGAGGGCCTGGGCCTGAGG + Intronic
968761653 4:2445369-2445391 GAGTGGACTGTGTGGGCCTGTGG + Intronic
968794413 4:2692974-2692996 GAGAGGATTGCTTGAGCCCAGGG + Intronic
969288256 4:6221955-6221977 GAGAGGGGTGGGCGGGGCCGAGG - Intergenic
969462040 4:7334093-7334115 GAGAGGAGGGTGAGGGGCCGGGG - Intronic
969621325 4:8280310-8280332 GGGAGGAGGGCCTGGGCCTGGGG + Intronic
969627077 4:8311138-8311160 GAGAGGAGGGAGTGGGACAGCGG - Intergenic
970467142 4:16335822-16335844 GGGAGGAGTGCTTGAGCCCGGGG + Intergenic
971293053 4:25361686-25361708 GAGGGGAGTGGGTGGACCAGTGG - Intronic
973726670 4:53783834-53783856 GAGAGGACTGCTTGAGCCCAGGG - Intronic
976297230 4:83484798-83484820 GAGAAGACTTCGTGGGCACGAGG + Intronic
979523745 4:121696804-121696826 GAGAGGAGAGCGTGGTCGCGGGG - Intronic
985348717 4:189035292-189035314 GAGAGGGGTGTGTGGGCGTGTGG - Intergenic
986298535 5:6459929-6459951 CGGAGGAGTGCATGGGCCCCAGG + Intronic
987507442 5:18792564-18792586 GAGGGGAGTGGGTGGACCAGTGG - Intergenic
989484477 5:41973448-41973470 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
990530319 5:56667031-56667053 GAGAGGACTGCGTGGGTGGGTGG - Intergenic
990560699 5:56980430-56980452 TAGAGGACTGCGTGGTCCCTGGG - Intergenic
991687301 5:69193405-69193427 GAGAGGATTGCTTGAGCCCAGGG + Intronic
992304537 5:75422523-75422545 GGGAGGACTGCTTGGGCCTGGGG + Intronic
993316845 5:86419019-86419041 GAGAGGACTGCTTGAGCCTGTGG - Intergenic
994340561 5:98622539-98622561 GTGCGGAGGGCGTGGGCGCGTGG - Intergenic
994981239 5:106876606-106876628 GAGGGGAGTTGGTGGGCCAGTGG + Intergenic
997200242 5:132005669-132005691 GACAGGGGTGCGTGGGCAGGAGG + Intronic
997346789 5:133198020-133198042 GAGAGGAGTGGATGGGCCACAGG + Exonic
1001324874 5:170715902-170715924 GAGAGAAGAGCGTGAACCCGTGG - Intronic
1001505988 5:172281125-172281147 GAGAGGATTGCTTGAGCCCCAGG - Intronic
1002590856 5:180291286-180291308 GAGAGGAGTGCGCGGGGAGGCGG + Intronic
1003098264 6:3158105-3158127 GAGAGGAGTGGGGGGCCGCGGGG + Intergenic
1004367093 6:15021751-15021773 GCGAGGAGTCCGTGGGACTGAGG - Intergenic
1006179341 6:32144995-32145017 GGGAGGATTGCTTGGGCCTGAGG - Intergenic
1006294456 6:33163878-33163900 GAGAGGTGAGCCTGGGCCTGAGG - Intronic
1006620796 6:35362621-35362643 GAGAGGAGGGCCTGGGTCCCTGG + Intronic
1007765181 6:44155650-44155672 GAGAGGAGAGAGTGGGGCTGGGG + Intergenic
1010724087 6:79313237-79313259 GAGGGGAGTGGGTGGGCAAGTGG + Intergenic
1011011836 6:82711860-82711882 AAGAGCAGTGCGTGAGCCCTGGG + Intergenic
1011113844 6:83867952-83867974 GAGGGGAGTGGGTGGGCAAGTGG - Intronic
1013093366 6:106921356-106921378 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1015317073 6:131828744-131828766 GAGGGGAATGTGTGGGCCTGGGG - Intronic
1016485707 6:144535869-144535891 GAGAGGATTGCTTGAGCCCAGGG - Intronic
1016923186 6:149316997-149317019 GAGAGGAGCAGGTGGGCCCGCGG - Intronic
1018419724 6:163631022-163631044 GAGAGGAGGACGGGGCCCCGGGG - Intergenic
1018431011 6:163722870-163722892 GAGAGGCGTCCGTGTGCCCTTGG - Intergenic
1019461307 7:1160324-1160346 GCGAGGAGTGGGCGGGCCTGCGG - Intronic
1019519520 7:1454448-1454470 GAGAGGAGGGGGTGGGCAGGGGG + Intronic
1019536072 7:1530600-1530622 GAGAGGAGGGCGTGGCCGGGGGG + Intergenic
1019738962 7:2663442-2663464 GAGGGGAGTCCATGGGCCTGGGG + Exonic
1020253223 7:6485640-6485662 GGGAGGATTGCTTGGGCCCAGGG + Intergenic
1020585950 7:10067666-10067688 GAGAGGATTGCTTGAGCCTGTGG + Intergenic
1020586269 7:10073340-10073362 GAGAGGATTGCTTGAGCCTGTGG - Intergenic
1021117620 7:16761607-16761629 GAGAGGATCGCTTGGGCCCAGGG - Intronic
1023804914 7:43865852-43865874 TAGAAGAGTGCTTGGGCCGGAGG + Intergenic
1024618143 7:51133144-51133166 GAGAGGACAGTGTGGGCCCCAGG + Intronic
1025164503 7:56700757-56700779 GGGAGGATTGCTTGAGCCCGTGG + Intergenic
1025921863 7:65920767-65920789 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1030139226 7:106287709-106287731 GGGAGGATTGCCTGAGCCCGGGG + Intergenic
1031088275 7:117324070-117324092 GAGAGAGGGGCTTGGGCCCGCGG + Intergenic
1031494094 7:122425076-122425098 GGGAGGATTGCTTGGGCCTGGGG - Intronic
1032107647 7:129047992-129048014 GAGAGAAGTGCTTGAGCCCAGGG + Intronic
1032194157 7:129780104-129780126 CAGAGGGGTACCTGGGCCCGAGG + Intergenic
1033287831 7:140057802-140057824 GAGTGGAATGGGTGGGCCCTTGG - Intronic
1033667652 7:143457945-143457967 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1034418352 7:150976781-150976803 GAGAGGTGGGGGTGGGCCCAGGG - Intronic
1036708347 8:11061235-11061257 GAGAGGATTGCTTGAGCCCCAGG + Intronic
1037316673 8:17605826-17605848 GGGAGGAGTGCGTGGGGCACAGG + Intronic
1040294061 8:46140129-46140151 GAGTGGAGTGGGTGGGCCGCAGG - Intergenic
1043429551 8:80181656-80181678 GAGAGGATTGCTTGAGCCCCGGG + Intronic
1043474928 8:80596842-80596864 GGGAGGATTGCTTGAGCCCGAGG + Intergenic
1043515811 8:80993688-80993710 GAGAGGATTGCTTGAGCCCAGGG - Intronic
1044800504 8:95949004-95949026 GAGAGGATTGCTTGAGCCCAGGG + Intergenic
1045323102 8:101096762-101096784 GAGAGGAGTGTGTGGGGGTGGGG + Intergenic
1045756776 8:105552899-105552921 GGGAGGATTGCTTGAGCCCGGGG - Intronic
1048833385 8:138497105-138497127 GAGAGGAGTGAGGGCGCCAGAGG - Intergenic
1049022381 8:139966312-139966334 GAGAGGAGCTTGTGGGCCCAGGG - Intronic
1049199827 8:141334566-141334588 GACAGAAGTGCGGGGGCCCCTGG - Intergenic
1049382732 8:142325503-142325525 GTGAGAAGTGCGTGGACACGGGG + Intronic
1049452610 8:142670139-142670161 GAGAGGAGTGGGGGGGTCCCAGG + Intronic
1049469358 8:142768566-142768588 GAGGGGAGTCCGTGGGCACCGGG + Intronic
1049585845 8:143432078-143432100 CAGAGGAGTGGGAGGGCCCAGGG - Intergenic
1049592383 8:143468552-143468574 GAGAGAGGTGCGTGAGCCTGAGG + Intronic
1049765292 8:144352594-144352616 GACAGGAGAGTGTGGGCCTGGGG + Intronic
1049838974 8:144758336-144758358 GGGAGGATTGCTTGAGCCCGGGG - Intergenic
1051390277 9:16556196-16556218 GGGAGGACTGCTTGGGCCCTGGG + Intronic
1052122637 9:24737874-24737896 GAGAGGAGGGCGTGGTCCCCTGG + Intergenic
1053479461 9:38405229-38405251 GTGAGAAGTGCGTGGGTCCAAGG - Intergenic
1056389176 9:86124714-86124736 GGGAGGATTGCTTGAGCCCGGGG + Intergenic
1056770198 9:89472865-89472887 GAGAGGAGTGCTTGAGCCCAGGG + Intronic
1056815445 9:89797477-89797499 TCGAGGAGTGCGCGGGCCCAGGG + Intergenic
1059109154 9:111538396-111538418 GAGAGGATTGCTTGAGCCCAGGG + Intronic
1059930103 9:119251839-119251861 GAAACGAGTCCCTGGGCCCGAGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061005785 9:127927891-127927913 GAGAGGAGGGCGAGGGCCGAAGG - Intronic
1061129912 9:128702951-128702973 GGGAGGGGCGCGCGGGCCCGGGG + Intronic
1061242797 9:129384045-129384067 GAGAGAAGTGGGTGGGGACGAGG - Intergenic
1061359488 9:130131971-130131993 GAAAGGATTGCCTGAGCCCGGGG - Intronic
1061882999 9:133577343-133577365 CAGAGGTGTGGGCGGGCCCGGGG + Intergenic
1061931147 9:133833824-133833846 CACAGGAGTGTGTGGGCTCGGGG - Intronic
1062070668 9:134553511-134553533 GAGAGGAGAGCAGGGGCCCGAGG + Intergenic
1062568046 9:137171911-137171933 GAGTGGAGTGCGGGGGCAGGAGG + Exonic
1189209804 X:39275618-39275640 GAGAGGAGTGGGTGGGAACCGGG + Intergenic
1190253959 X:48748501-48748523 GAGAGGATTGCTTGAGCCCAAGG + Intergenic
1192402920 X:70854954-70854976 GAGAGGATTGCTTGAGCCCGGGG + Intronic
1197626458 X:128807746-128807768 GAGGGGAGTGGGTGGGCAAGTGG - Intergenic
1199770079 X:150969595-150969617 GAGAGGAGGGAGAGGGCCTGAGG + Intergenic
1200223740 X:154405130-154405152 GAGAGGAGGCAGTGGGCCCAGGG + Intronic