ID: 901808105

View in Genome Browser
Species Human (GRCh38)
Location 1:11750394-11750416
Sequence CCAGTGGGTGCCCTGAAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901808105_901808118 22 Left 901808105 1:11750394-11750416 CCTCCCTTCAGGGCACCCACTGG 0: 1
1: 1
2: 2
3: 24
4: 222
Right 901808118 1:11750439-11750461 TCTCTTTACCTCCTACCCCATGG 0: 1
1: 0
2: 3
3: 29
4: 257
901808105_901808113 -4 Left 901808105 1:11750394-11750416 CCTCCCTTCAGGGCACCCACTGG 0: 1
1: 1
2: 2
3: 24
4: 222
Right 901808113 1:11750413-11750435 CTGGTTCCCAGGCTGGAACCAGG 0: 1
1: 0
2: 2
3: 65
4: 708
901808105_901808119 25 Left 901808105 1:11750394-11750416 CCTCCCTTCAGGGCACCCACTGG 0: 1
1: 1
2: 2
3: 24
4: 222
Right 901808119 1:11750442-11750464 CTTTACCTCCTACCCCATGGTGG 0: 1
1: 0
2: 0
3: 9
4: 121
901808105_901808114 -3 Left 901808105 1:11750394-11750416 CCTCCCTTCAGGGCACCCACTGG 0: 1
1: 1
2: 2
3: 24
4: 222
Right 901808114 1:11750414-11750436 TGGTTCCCAGGCTGGAACCAGGG 0: 1
1: 0
2: 0
3: 25
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901808105 Original CRISPR CCAGTGGGTGCCCTGAAGGG AGG (reversed) Exonic
900595039 1:3476720-3476742 CCAGGGGGTGTCCTTCAGGGTGG + Intronic
900798631 1:4724439-4724461 CCAGGGGGTGCCCAGAGGTGGGG - Intronic
901808105 1:11750394-11750416 CCAGTGGGTGCCCTGAAGGGAGG - Exonic
902401776 1:16161886-16161908 CCAGCAGCAGCCCTGAAGGGTGG - Intergenic
903262995 1:22141466-22141488 TCAGGGGGTGGCCTGCAGGGGGG + Intronic
910249509 1:85181066-85181088 CCACTGGGGGGCCTGAAGAGGGG + Intronic
910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG + Intergenic
912645765 1:111390335-111390357 CTAGTGTGTGACCAGAAGGGAGG - Intergenic
913554795 1:119954622-119954644 CCAGTGTGTGCTCTGAAGTAGGG - Intronic
914883903 1:151569572-151569594 CCAGTGTGTGCCTGGGAGGGGGG + Intronic
915338048 1:155159139-155159161 ACTGTGGGTGCCCTGAGGGCAGG - Intergenic
915467041 1:156104007-156104029 TCAGTGGGGGCTGTGAAGGGGGG - Intronic
917782387 1:178411963-178411985 CCTGTGGGTGCCGTCAAGAGGGG - Intronic
922029223 1:221781923-221781945 GCAGTGGCTGTCCTGAGGGGTGG + Intergenic
922718792 1:227889903-227889925 CCCCTGGGTGCCTTGCAGGGTGG - Intergenic
923005534 1:230046382-230046404 CGAGTGGATGCCCAGGAGGGAGG - Intergenic
924404598 1:243730024-243730046 GCTGTGTGTGCCCTGAAGGTTGG - Intronic
1066459885 10:35603777-35603799 TCAGAAGATGCCCTGAAGGGTGG + Intergenic
1067018468 10:42774973-42774995 CCAGTGGCTGCACTGATGGCAGG + Intergenic
1067546818 10:47197718-47197740 CCAGTTGGTGCCCTGCCTGGAGG + Intergenic
1069556455 10:69401617-69401639 ACAGTGGGTGCCAGGAGGGGAGG - Exonic
1069902723 10:71715265-71715287 AACGTGGGTGCCCTGAAGAGGGG + Exonic
1070801207 10:79245362-79245384 CCAGTGGGCTCCCTGAAGGCAGG + Intronic
1072664427 10:97383582-97383604 CCAGTTGGTGACCTGCATGGAGG - Intronic
1072960677 10:99926533-99926555 CTAGGGAGTGCCCTGAGGGGAGG - Intronic
1073358639 10:102878155-102878177 CCAGTGAGTGTCCTGAAGAATGG + Intronic
1075462685 10:122628800-122628822 TCAGTGGGTGCCAGGAATGGAGG + Intronic
1076266256 10:129111870-129111892 CCAGTGGGTGGCATGAAGCCTGG - Intergenic
1076412399 10:130261632-130261654 GCAGAGGGTGCCCAGGAGGGTGG + Intergenic
1076795530 10:132796249-132796271 CCTGTGGGCGCCCCGGAGGGAGG + Intergenic
1076873671 10:133205590-133205612 CCAGTGGGTTCCCGGGAGGAGGG + Intronic
1077492590 11:2868971-2868993 CCAGAGGGGGCCCTGGAGGGAGG + Intergenic
1078891103 11:15559968-15559990 CTAGTGGGTGCAGTGAGGGGAGG - Intergenic
1082990957 11:59206813-59206835 CCAGAGGGAGCTCTGATGGGAGG + Exonic
1084491503 11:69481119-69481141 CCAGTGGCTGCTCTGACGGAAGG - Intergenic
1085988765 11:81814164-81814186 TCAGGGGGTGAGCTGAAGGGAGG + Intergenic
1087211962 11:95453967-95453989 CCAGTGCGGTCCCTGGAGGGCGG - Intergenic
1089146109 11:116330690-116330712 CCAGTGTGTGCACAGAGGGGTGG - Intergenic
1089254262 11:117186061-117186083 CCTTTGGGTGCCATGATGGGAGG + Intronic
1093165623 12:15801960-15801982 ACACTGCATGCCCTGAAGGGTGG - Intronic
1094479749 12:30872219-30872241 AGGGTGGGTGCCCTGAAGGTGGG - Intergenic
1095346538 12:41156704-41156726 TCAGTGGGTGGGGTGAAGGGAGG - Intergenic
1096554805 12:52396809-52396831 CCAGTCTGTGCCGTGCAGGGCGG - Intronic
1099492818 12:83307413-83307435 CCAGTGGGTACTCTGTATGGGGG - Intergenic
1102008877 12:109606099-109606121 CCAGCTGTTGCCCTGCAGGGTGG + Intergenic
1102680749 12:114688704-114688726 CTAGTGTCTGCCCTGGAGGGAGG - Intergenic
1103012256 12:117466336-117466358 TCAGGGGGTGCCCTGAATGACGG + Exonic
1103084684 12:118053259-118053281 CCAGAGTGTGGCCTGCAGGGAGG - Intronic
1104467108 12:128999557-128999579 CCAGTGGGGCCCCTGCAGGGAGG + Intergenic
1104692832 12:130839320-130839342 CCAGCGGGAGCCCGGAGGGGCGG + Intergenic
1104925303 12:132310895-132310917 AGAGTGGGTGCCCTGAAGGATGG - Intronic
1105378215 13:19863764-19863786 CGAGGGGGCGCCCTGAAGGACGG - Intergenic
1105389018 13:19958588-19958610 CGAGGGGGGGCCCTGAAGGACGG + Intergenic
1105422992 13:20269641-20269663 CCAGTGGCTGCCATGCTGGGCGG + Intergenic
1106460100 13:29961005-29961027 CCATTAGATGCCCTGAGGGGTGG - Intergenic
1109492346 13:63117921-63117943 CCAGTGGGCGCCCCGAACGCGGG - Intergenic
1110516417 13:76418149-76418171 CCAATAAGTGCCCTGAAAGGAGG + Intergenic
1114549252 14:23523774-23523796 CCAGTGGGGGACCTGGAGGTGGG - Exonic
1116739818 14:48739963-48739985 CCAGTGGTAACCCTGAAGAGAGG + Intergenic
1117424320 14:55579892-55579914 CCAGGTGGTGCCCTGGAGGGAGG + Intronic
1119177259 14:72578277-72578299 CCAGGGGGTGCCATCAAGGGAGG - Intergenic
1119543442 14:75455604-75455626 CCAATGGGTGCCCAGCAGGGAGG - Intronic
1119703217 14:76768903-76768925 CAAGGGGGAGCCCTGAGGGGTGG + Intronic
1121886257 14:97545828-97545850 CCAGTAGGTGGCCTGGAGGTTGG + Intergenic
1122440960 14:101731524-101731546 CCAGATGGAGCCCTGGAGGGTGG + Intronic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1122552388 14:102557004-102557026 CCAGTCTGTCCCCTGAGGGGTGG - Intergenic
1122628945 14:103098735-103098757 ACAGATGGTGCCCTGAAGTGTGG + Intergenic
1122691527 14:103534044-103534066 CCCGTGGCTGCCCTGGTGGGAGG + Intronic
1122837307 14:104436550-104436572 CCAGGGGGTGCCCGGGAGGCTGG - Intergenic
1122891432 14:104733904-104733926 CCAGTGGCTGGCCAGAAGTGGGG + Intronic
1123040806 14:105489533-105489555 CCAGTGGGTGTCCGGAGGGGTGG - Intronic
1124432369 15:29618704-29618726 CCAGAGGCTGCCCTGATGGGTGG + Intergenic
1124443246 15:29705351-29705373 GCAGTGGGTGGCCTGAAGCAAGG - Intronic
1125227021 15:37407268-37407290 CCACTGGGTGACATGAAGAGGGG - Intergenic
1126163479 15:45634790-45634812 CCCTTGCGCGCCCTGAAGGGCGG - Exonic
1128065180 15:64760099-64760121 CCTGTGTGTGCCCTGGAAGGAGG - Intronic
1128100310 15:64993177-64993199 CTAATGGGTGCACTGGAGGGAGG - Intergenic
1129116333 15:73367442-73367464 CCTGTGGGTGCCCTGCGCGGTGG - Intronic
1129187891 15:73921636-73921658 CCAGTGGGTGCCCAGGCTGGTGG - Intergenic
1129465830 15:75723745-75723767 CCAGTGGGTGCCCTAAGGTTGGG - Intergenic
1132612671 16:825047-825069 CCCTGGGGTGCCCTGGAGGGCGG + Intergenic
1132614092 16:831792-831814 CCAGCGGGTGCCTGGGAGGGGGG + Intergenic
1132959219 16:2612854-2612876 CCTGCGGGTGCCCTGGAGGCCGG - Intergenic
1132972279 16:2694829-2694851 CCTGCGGGTGCCCTGGAGGCCGG - Intronic
1137853890 16:51773733-51773755 CCAGCGCATGCCCTGCAGGGGGG + Intergenic
1138416173 16:56872587-56872609 CCAGTGGGTCCCAGCAAGGGGGG + Intronic
1139484915 16:67249954-67249976 CCACTGGCTGCTCAGAAGGGAGG - Intronic
1141961502 16:87412214-87412236 CCAGTGGGCCCCCTGCAGGGTGG - Exonic
1143373690 17:6455331-6455353 CGAGTCGGTGCCCTGAGGGGTGG - Exonic
1144819125 17:18059134-18059156 CCAGTGCGTGCCCTGGAGCTGGG - Intronic
1146289929 17:31599562-31599584 GCAGTGGGAGCCCAGCAGGGAGG + Intergenic
1148205687 17:45778488-45778510 CCAGTGGATGGGCTAAAGGGGGG - Intergenic
1149112347 17:53048620-53048642 CCAGTGGGGACCCTGAGTGGAGG + Intergenic
1150469352 17:65423579-65423601 TCAGTGGGTGTCCTCCAGGGAGG - Intergenic
1151684432 17:75638536-75638558 GCGGTGTGTGCCCTGAAGGAAGG - Exonic
1152379320 17:79934296-79934318 CCAGTTGGTGGCCTGAGGTGGGG + Exonic
1152537980 17:80961322-80961344 CCGGTGAGAGCCCCGAAGGGTGG + Intronic
1152703745 17:81832697-81832719 CCAGTGAGTGCCTAGAAGGCAGG + Intronic
1153089809 18:1330868-1330890 CCAGTGGGTGACCTGATCAGAGG + Intergenic
1156282667 18:35656352-35656374 ACTGTGAGTTCCCTGAAGGGAGG - Intronic
1156388175 18:36625557-36625579 CCAGTGGGTGCCGGGACCGGAGG + Exonic
1157796694 18:50581423-50581445 CACGTGTGTGCCCTGGAGGGAGG - Intronic
1158151707 18:54381371-54381393 CCAGTGAAGGTCCTGAAGGGTGG - Exonic
1160840632 19:1145656-1145678 CCTGTGCGTCCCCTGAAGGGTGG + Intronic
1161103145 19:2431293-2431315 CCAGGGGGTCCCCTGAGAGGTGG - Intronic
1161698971 19:5784787-5784809 CCAGTGGGCGCGCTGCAGGCTGG - Intronic
1163861829 19:19746966-19746988 CCAGTGGGGGCCCTGAGCTGAGG - Intergenic
1164536186 19:29087945-29087967 GCAGTGGGGGGCCTGGAGGGAGG + Intergenic
1164720055 19:30425324-30425346 CCAGGGGGTGTCTGGAAGGGAGG + Intronic
1166231486 19:41427644-41427666 CCAGGGGGTGCCAGGGAGGGTGG + Intronic
1166267475 19:41694271-41694293 CCACTGGGAGCCCTGAGGGTAGG - Intronic
1167294081 19:48639293-48639315 ACAGAGGGTCACCTGAAGGGAGG + Exonic
1167673630 19:50871003-50871025 CCAGAGGGGGCCATGACGGGTGG + Intronic
1167690602 19:50982279-50982301 TCAGTGGGGGCCCTGAGGTGAGG + Intronic
1168095937 19:54114894-54114916 CCTGTGGGTGCTGCGAAGGGTGG - Intronic
925271619 2:2613732-2613754 GCAGAGGGTGCTCTGAGGGGCGG + Intergenic
925284266 2:2705672-2705694 CCAGTGGCAGCCGTGGAGGGAGG + Intergenic
925305833 2:2847471-2847493 CCAGGGGTGGCCCTGCAGGGAGG - Intergenic
929603529 2:43219748-43219770 CCAGGAGGAGCCCTGCAGGGAGG - Intergenic
929832771 2:45361116-45361138 ACAGTGGATGCCCTTGAGGGAGG + Intergenic
929900794 2:46001609-46001631 CCAGAGGGTGCTCTGGAGTGAGG + Intronic
932572730 2:72946418-72946440 GCAGTGGGTGTCGTGAAGTGGGG - Intronic
933947597 2:87300151-87300173 ACAGTGAGTGCCTTGAAGGCAGG + Intergenic
935340253 2:102053338-102053360 CCAGAGGATGCCATGAAGGGAGG + Intergenic
936332599 2:111561426-111561448 ACAGTGAGTGCCTTGAAGGCAGG - Intergenic
937271300 2:120654682-120654704 CCAGTGGCTGGCCTGGAGCGGGG - Intergenic
937363361 2:121244188-121244210 CCAGTGCGTGCCCTGCATGCAGG - Intronic
938031012 2:127993244-127993266 CCAGTGGGTATGCAGAAGGGGGG + Exonic
942081482 2:172403358-172403380 CCAGAGGGAGCCCTGAAAGGGGG + Intergenic
942944358 2:181656960-181656982 CGGGTGAGTGCCCTGGAGGGCGG - Exonic
945151309 2:206795204-206795226 GCAGTGGCTGCCCAGAAGGCAGG + Intergenic
946272671 2:218607502-218607524 ACAGTGAGTGCCCTGCAGGCAGG + Intergenic
947590661 2:231383282-231383304 CCAGGGAGGGCCCTGAAGGTAGG + Intergenic
948720484 2:239896528-239896550 CCAGTGGGGCCACGGAAGGGAGG + Intronic
948773856 2:240269869-240269891 CCAGTGGGGGCACTGTAGGCAGG + Intergenic
948917338 2:241041161-241041183 CCAGGGTGTGTCCTGAGGGGAGG + Intronic
1171345650 20:24464280-24464302 CCAGTGGGTGGCCAGCAGGGCGG - Intergenic
1172177346 20:32980397-32980419 CCAGTGGGTGGGCTGAGTGGCGG + Intergenic
1172278918 20:33696921-33696943 GCAGAGGGTGCCCTGTAGAGTGG - Intergenic
1173617299 20:44411471-44411493 CCACTCGGCGCCCTGATGGGTGG + Intronic
1173691599 20:44965392-44965414 CCATGGGTGGCCCTGAAGGGTGG + Intergenic
1175302309 20:57951595-57951617 GCAGTGGGGGCCAGGAAGGGAGG - Intergenic
1175466574 20:59193925-59193947 GCAGTGGGTGGCCTGAAGAACGG + Exonic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175815381 20:61880770-61880792 GCAGTGCGTGCTCTGAAGGTTGG + Intronic
1175831203 20:61966208-61966230 CAAGTGGGTGCTCTGAGGAGGGG + Intronic
1176171816 20:63699609-63699631 CCAGTGGGGTCCGTGCAGGGAGG + Exonic
1176365121 21:6028048-6028070 TCAGTGGCTGCCTTGCAGGGAGG + Intergenic
1177763850 21:25434218-25434240 CCAGTGGGTGCCCCTCTGGGAGG + Intergenic
1179758397 21:43510497-43510519 TCAGTGGCTGCCTTGCAGGGAGG - Intergenic
1181002157 22:19992884-19992906 CCAGTGGGCCCCCTTTAGGGTGG - Intronic
1181088672 22:20457359-20457381 CCTCTAGGTCCCCTGAAGGGTGG - Intronic
1181310479 22:21942028-21942050 CCAGTGGGGGCCCTGGAAGCTGG + Intronic
1184435062 22:44467852-44467874 CAAGTGGGTGACCTGAAGTCAGG - Intergenic
1185001731 22:48250419-48250441 CCAGTGAGTGCCCTGAAGGGTGG + Intergenic
1185383757 22:50522285-50522307 CCCGTGGTGGCCCTGATGGGAGG + Intronic
950667656 3:14506899-14506921 CCAGCAGATGCCCTGAAAGGAGG - Exonic
950854051 3:16088915-16088937 CCACTTGGTGGGCTGAAGGGAGG + Intergenic
951400274 3:22224790-22224812 GCAGTGGGTGCCCAGAAAGTTGG - Intronic
952411985 3:33057640-33057662 CCAGTGGCTGACCTCAAGGTTGG + Intronic
953431557 3:42844581-42844603 CCAGTGTGTGCCCAGCAGGTGGG + Intronic
953915540 3:46918171-46918193 CCAGTGGATGCCCGAAATGGTGG + Intergenic
954424562 3:50436513-50436535 CCTGTTGGTGCCCTGAGGTGTGG - Intronic
954496097 3:50963799-50963821 CCAGTGGGTTCACTGAACTGAGG + Intronic
954713836 3:52517449-52517471 CCCGGGCCTGCCCTGAAGGGAGG - Intronic
956675637 3:71729433-71729455 CCAGTGGCTCCCTTGAAAGGAGG + Intronic
957131373 3:76226399-76226421 CTGGTGTGTGCCCTGAAGGGTGG + Intronic
959107346 3:102079636-102079658 CCACCGAGTGCCCTTAAGGGAGG + Intergenic
961383693 3:126512198-126512220 ACTGTGGGTGGCCTGGAGGGAGG + Intronic
961385592 3:126521653-126521675 CCAGAGGGTGCCCCGAGGGCTGG + Intergenic
961960520 3:130849496-130849518 CAAGTGTGTTCCCTGAAGGCAGG + Intergenic
962943530 3:140147182-140147204 CCAGTGGGTCCTCTGAGGTGTGG + Intronic
964282391 3:155080255-155080277 CCAGAGGGTGACCTGGAGGAGGG + Intronic
964810720 3:160661215-160661237 ACATAGGGTGCCTTGAAGGGTGG + Intergenic
967749880 3:193101590-193101612 CCAGTGGGTGCTCTGAATGGGGG - Intergenic
968182784 3:196609505-196609527 CCAAGGGGTGCCCTGTGGGGAGG + Intergenic
968556972 4:1250395-1250417 CCAGTGGGAGTCATGAAGGAGGG + Intergenic
969193195 4:5540654-5540676 CAAGGGGGTGCCCTAGAGGGAGG + Intergenic
969583051 4:8076754-8076776 CCAGAGGGTGGGCTGCAGGGTGG + Intronic
970987640 4:22176781-22176803 CCTGTGGGTGCCCAGAAGTCAGG - Intergenic
975198055 4:71549419-71549441 CCTGTGGGTTCCTTGAAGGTGGG + Intronic
975301691 4:72797808-72797830 CCAGTGGGGGCTCTGTATGGGGG + Intergenic
975634691 4:76435948-76435970 CCATTGTGTGTCCTGAAGGATGG + Exonic
979051783 4:115944281-115944303 CCAGTGGGTGACCTTAACAGTGG + Intergenic
982206025 4:152997754-152997776 AGAGTGGGTGTCCTGAGGGGAGG - Intergenic
983252954 4:165365457-165365479 CCATTGGGTGCTCTGAAGCTGGG + Intronic
989802833 5:45565257-45565279 CCAGTGGGAGCAATGAATGGAGG + Intronic
990659979 5:58002396-58002418 CCAGTGGATGCCCAGAAGTATGG + Intergenic
996652310 5:125894311-125894333 CCAGTGGGTGACCAGAATGTTGG + Intergenic
997664663 5:135620343-135620365 CCACTGGGTGGCCCGAAGGAAGG - Intergenic
998792050 5:145776591-145776613 CCAGTGGGTGCCTGAAACGGTGG - Intronic
1001525129 5:172423512-172423534 CAAGTGGGTGAGCTGAAGGTAGG - Intronic
1003592258 6:7446053-7446075 CCAGGAGGTGCCGTGCAGGGTGG - Intergenic
1003862488 6:10335285-10335307 ACAGTGGGTTCCTTGAAGAGGGG + Intergenic
1006393194 6:33770900-33770922 CCAGTGGGTGGCCAGAAGTGGGG - Intergenic
1007693948 6:43719835-43719857 CCACTGGGTGCTCTGAAAGGAGG - Intergenic
1007829132 6:44624921-44624943 CTACTGGATGCCCTGGAGGGTGG + Intergenic
1008620421 6:53266009-53266031 CCAGTGGTTGCTCTGAGGGTTGG - Intergenic
1015732220 6:136360855-136360877 CCAGGGGGTGCCCAGAGGTGGGG + Intronic
1016250511 6:142035520-142035542 CGAGTGGGTCGCCTGAAGTGAGG - Intergenic
1018522678 6:164668803-164668825 CTAGAGGGGGCCCTGAAGGAAGG + Intergenic
1018688162 6:166319385-166319407 CCAGTGGGAGACTTGCAGGGAGG + Intergenic
1018740567 6:166725561-166725583 TCTGTGGGTGCCTCGAAGGGAGG + Intronic
1019938802 7:4273383-4273405 CCCATGGGGTCCCTGAAGGGAGG + Intergenic
1022226835 7:28371799-28371821 CCAGTGGGAGCCCCGAGGGCAGG + Intronic
1023643137 7:42281720-42281742 CCAGTGGGTGCACAAAAGGCAGG - Intergenic
1023659519 7:42458098-42458120 CCACTGGGTGCCCAGAAGGCAGG - Intergenic
1023984654 7:45087805-45087827 TCACTGGGTGCCCTGAAGCTGGG + Intronic
1026050590 7:66943302-66943324 CCAGTGGTTGCACTGAAGCCTGG + Intronic
1026377627 7:69767800-69767822 ACAGTGTGTGCCATGAAGAGGGG - Intronic
1028987070 7:97017226-97017248 CGGGTGGGTGCCCAGACGGGAGG + Intergenic
1029914919 7:104199161-104199183 CCAGTGGGGACTCTGTAGGGGGG - Intronic
1032438094 7:131918876-131918898 ACAGTGGTTGCCATGGAGGGAGG + Intergenic
1032500895 7:132398899-132398921 CCTGTGGGTGTCCTGAGGTGGGG - Intronic
1032807918 7:135376064-135376086 TCAGTGGGTGACGTGTAGGGGGG + Intronic
1033496073 7:141897570-141897592 CCAGTGGGTGCCCTGCACTGTGG - Intergenic
1034168322 7:149042893-149042915 ACAGTGGGAGCCCTGGAGTGTGG + Intergenic
1034460392 7:151194816-151194838 CCAGTGGGTGCTCTGTAAGAGGG + Intronic
1034706735 7:153152448-153152470 CCACTGGGAGCCCTGAAGCTGGG + Intergenic
1035640554 8:1181843-1181865 CCAGGGGGTGCCGTGCAGGGAGG - Intergenic
1037521056 8:19681180-19681202 GCAGTGGGGGCTCTGCAGGGAGG - Intronic
1037783331 8:21886299-21886321 CCAGTAGGTGCCCTGAAGTGGGG - Intergenic
1037940589 8:22948076-22948098 CCAGAGGGTCCCTTGAAGGAGGG - Intronic
1045559309 8:103245606-103245628 CAAGTGAGTCCCCAGAAGGGAGG - Intergenic
1045656721 8:104394517-104394539 CCAGTGGGAGCCATGGAGTGGGG - Intronic
1045861579 8:106819593-106819615 CCATTGTGTGCCTTGAAAGGGGG + Intergenic
1047797915 8:128277052-128277074 CCAGTGTATGCCCTGGAGGCTGG - Intergenic
1048879306 8:138859681-138859703 TCAGTGGGTGCCCTGGAAGGAGG - Intronic
1049575692 8:143388716-143388738 CCAGTGGGTTCCCAGGGGGGCGG + Intergenic
1052198043 9:25742365-25742387 CCAGAGGGTCCCCTGACAGGAGG - Intergenic
1056187094 9:84146034-84146056 ACAGTGGGTGCCCTGAGAGTGGG + Intergenic
1057880644 9:98790425-98790447 CCAGTTGCTCGCCTGAAGGGTGG + Exonic
1058360734 9:104143259-104143281 CCTGTGGGATCCCTCAAGGGTGG + Intergenic
1059440503 9:114304180-114304202 CCAGATGGTGCATTGAAGGGAGG + Intronic
1060405393 9:123370525-123370547 CCAGAGTGTGGCCTGAAGTGTGG - Exonic
1060530952 9:124346742-124346764 CCTGTGAGTGCCCTGAGTGGTGG + Intronic
1062228462 9:135467251-135467273 CCAGTGGGTTTCCTGCAAGGAGG + Intergenic
1062537272 9:137026556-137026578 CCTCTGGGAGCCCTGTAGGGTGG + Intronic
1186262256 X:7791930-7791952 CCAGTGGCTGCACTGAGGGGTGG - Intergenic
1189435719 X:40990962-40990984 CCAGTGGGGGCTCTGTATGGGGG + Intergenic
1189995459 X:46633119-46633141 CAAGTGGCTGCCGTGAAGGTCGG - Intronic
1192673169 X:73167712-73167734 CCAATGGGTGACCTCAACGGAGG - Intergenic
1193184905 X:78500932-78500954 GCAGTGTGTGCCTTGAAGAGAGG + Intergenic
1193370747 X:80694382-80694404 CCAGTGGGGGCTCTGTATGGGGG - Intronic
1194638400 X:96373572-96373594 CCAGTGGATGCCTTGAGAGGAGG + Intergenic
1199223468 X:145343834-145343856 CCTGTGGCTGCTCTCAAGGGTGG + Intergenic
1199287305 X:146067939-146067961 TCAGCGGGAGCCCTGAAGTGAGG - Intergenic
1199988817 X:152972359-152972381 CCTTTGGGAGGCCTGAAGGGAGG - Exonic
1200353742 X:155526371-155526393 CCTATGGGTGCCCAGAAGGCAGG + Intronic