ID: 901808125

View in Genome Browser
Species Human (GRCh38)
Location 1:11750456-11750478
Sequence GGGCCTCTGTGGTGCCACCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901808125_901808131 12 Left 901808125 1:11750456-11750478 CCATGGTGGCACCACAGAGGCCC 0: 1
1: 0
2: 2
3: 18
4: 219
Right 901808131 1:11750491-11750513 TGCCTGAGTGTTGCAAGCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 102
901808125_901808133 21 Left 901808125 1:11750456-11750478 CCATGGTGGCACCACAGAGGCCC 0: 1
1: 0
2: 2
3: 18
4: 219
Right 901808133 1:11750500-11750522 GTTGCAAGCTCAGGCCTTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901808125 Original CRISPR GGGCCTCTGTGGTGCCACCA TGG (reversed) Exonic
900097391 1:945492-945514 GGGCCTGCGTGGTGCTCCCAGGG - Intronic
900339740 1:2182402-2182424 GGGTCCCTGGGGTGCCATCATGG + Intronic
900385794 1:2410079-2410101 GTGACTCACTGGTGCCACCAGGG + Intronic
900663847 1:3800373-3800395 GGTAGTCTGTGGTGCCACCTGGG + Intergenic
901078616 1:6571167-6571189 GGGCGGCTGTGGTGGCAGCACGG - Exonic
901636949 1:10674914-10674936 GGCCCTCTGTCGTGGCAGCAGGG + Intronic
901763974 1:11488350-11488372 GGGCCTCTGTGCTGGTCCCAGGG + Intronic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
901811918 1:11772211-11772233 GGGGCTCAGTGGGGCCACCCAGG - Exonic
903566034 1:24266525-24266547 TGGCCTCTGGAATGCCACCACGG + Intergenic
903950356 1:26993045-26993067 GCTCCTCTGTGATGCCACCAAGG + Intergenic
905293610 1:36940268-36940290 GGGCCTCTGTGGGGCTACCAGGG - Intronic
905803140 1:40858671-40858693 GAGCTTCCGTGGTGCCAACAGGG - Intergenic
906101941 1:43269661-43269683 GTGCCTCTTTGGTGCACCCATGG - Intronic
906186157 1:43863703-43863725 GGGCCTCTGTGGGGTCTCCCAGG - Intronic
907177140 1:52534810-52534832 GGGGTTCAGTGGTGCCATCACGG - Intronic
907554718 1:55334151-55334173 GGGCCTCAATGGGGCCACCCTGG + Intergenic
910245403 1:85133288-85133310 GGGCCTCTGTGTGGACAGCAAGG - Intergenic
912524664 1:110272431-110272453 GGGCCTCTATGGTGTCTCTATGG - Intronic
913021791 1:114795489-114795511 GTCACTCTGTGGTGCCACCTGGG - Intergenic
920249876 1:204616465-204616487 GGGCCACTGTGGACCCATCAAGG - Intergenic
922222860 1:223621747-223621769 GGTACTCTGTGATGCCACCAGGG - Intronic
922743500 1:228030032-228030054 GGAGCTCAGTGGTGCCATCATGG - Intronic
923199437 1:231697103-231697125 GGGCCTCTGTGTAAGCACCATGG - Intronic
924286849 1:242496085-242496107 GTGCCTCTGTTGTACAACCAGGG + Intronic
924325530 1:242890806-242890828 GGGCCTCTGAGGTGCTGCCCAGG + Intergenic
1066316259 10:34249817-34249839 AGGCATCTGTGCTGCCACCTAGG - Intronic
1067661158 10:48237193-48237215 GGGCTTCTATAGTGCCCCCAAGG + Intronic
1069242809 10:66163322-66163344 GGATCTCTGTGGTGCCAGGAAGG + Intronic
1069852544 10:71419399-71419421 GGGCCTGGGTGTTGCCTCCAGGG - Intronic
1072983983 10:100123391-100123413 GGAGTTCAGTGGTGCCACCATGG + Intergenic
1074116351 10:110460023-110460045 GGGACTCTGTGGGGGCTCCAGGG - Intergenic
1074985900 10:118659156-118659178 GGATCCCTGTGGTGCCAGCAGGG + Intergenic
1074986932 10:118667182-118667204 AGGGCTCTGAGTTGCCACCAAGG + Intergenic
1075879753 10:125840634-125840656 GGAGCTCTGGTGTGCCACCATGG - Intronic
1076044787 10:127283054-127283076 GGGCCTGTTTGGCGCCAACAAGG + Intronic
1077069647 11:662752-662774 GGACCATTGTGGTGCCATCATGG - Intronic
1077391567 11:2302849-2302871 GGGCCTCTCTGTGGCCACCATGG + Exonic
1078175173 11:8964581-8964603 GGGCCTCTGGGGTGGCAGCCTGG + Exonic
1081867888 11:46369613-46369635 GTGCCTCTGGAGTGCCACCAGGG + Intronic
1082959214 11:58902871-58902893 GGGAATCTGTTGAGCCACCAAGG - Intronic
1083742123 11:64716609-64716631 GGGCTTATGTGGTGCCTCCAGGG + Intronic
1084426530 11:69087153-69087175 TGGCCTCTGGGGTCCCAGCAAGG - Exonic
1084666866 11:70581029-70581051 GGCCTTCTGAGGAGCCACCAGGG + Intronic
1084785131 11:71437711-71437733 GGGCAGCTTTGGTGCCCCCAAGG + Intronic
1084936087 11:72587468-72587490 GGGCCTCAAAGCTGCCACCAAGG + Intronic
1085783101 11:79427059-79427081 GGGCTTCTCCAGTGCCACCATGG + Intronic
1089005800 11:115089737-115089759 GGGTCTCAGGGGTGTCACCAGGG - Intergenic
1089632175 11:119790639-119790661 GAGCTTCTGTGGGGACACCAGGG + Intergenic
1089937388 11:122378086-122378108 GGGCCCCTGTGGTGCCAGGCAGG - Intergenic
1090404104 11:126466984-126467006 GGGACTCTTGGGAGCCACCATGG - Intronic
1090961158 11:131558210-131558232 GGGGCTCTGTGCTGCTCCCAAGG - Intronic
1091295995 11:134474376-134474398 GGGCCTCTGCGGTGGCTCCAGGG - Intergenic
1096770445 12:53932957-53932979 GGGCCTCCTTAGTCCCACCATGG - Intergenic
1096983434 12:55742351-55742373 GGCTCTCTGTGCTCCCACCAAGG + Intergenic
1101598499 12:106188594-106188616 GGGCCTCTGTGGTGTCCAAAGGG - Intergenic
1101757198 12:107630176-107630198 CAGCATCTTTGGTGCCACCACGG + Intronic
1103716397 12:122947739-122947761 GGCCCGCTGTGATGCCATCATGG - Intronic
1103838330 12:123842070-123842092 GGGGCCCTGTGCTGCCACCAGGG - Intronic
1104276505 12:127333489-127333511 TGGCCTCTGTGGTTGGACCATGG + Intergenic
1104898620 12:132176143-132176165 GGGCCTCAGGGGTGCAGCCAGGG - Intergenic
1104993245 12:132638599-132638621 GGGCCTCTGTGGGGCCGCTCTGG + Intronic
1105600110 13:21879034-21879056 GGGCCACTGTGGTGACTGCAAGG - Intergenic
1106304646 13:28498674-28498696 CGGCCCCAGAGGTGCCACCAGGG - Intergenic
1107155113 13:37157080-37157102 GGTGCTATGTGGTGCCATCATGG + Intergenic
1107875012 13:44782754-44782776 CGGCCACTTTGGTGCCAGCAGGG + Intergenic
1110799444 13:79678078-79678100 GTGCCCCTGAGATGCCACCATGG - Intergenic
1113229185 13:108194496-108194518 GGCGCTCTGTGGAGCCAGCAGGG + Intergenic
1113380215 13:109797217-109797239 GGGGCCCTGTGGTGCCTACAGGG + Intergenic
1113420806 13:110170209-110170231 GGGCATCTGTGCTACCACTACGG + Intronic
1114672001 14:24416404-24416426 GGGCCTCTGGTGGGCCCCCAAGG - Exonic
1118141700 14:63090934-63090956 GGGCCTATGTTCTGGCACCATGG - Intronic
1118654697 14:67934081-67934103 GGTCTTCTGTGGTGCCAGCTTGG - Intronic
1119263187 14:73250264-73250286 GGGCATCTGTGATGCCTGCAAGG - Intronic
1119484664 14:74979765-74979787 GGGCCTGTGTGCTCCCTCCACGG + Intergenic
1120847688 14:89140269-89140291 GGGCCTCTGTGTGACCAGCAAGG + Intronic
1121261621 14:92570287-92570309 GGAACTCTGGGGTGCCCCCAGGG - Intronic
1121492079 14:94368167-94368189 GGGACTCTGTGGTGCATCCTAGG + Intergenic
1121701210 14:95955451-95955473 GAGGCTCTATGGTGCCAACAAGG - Intergenic
1122115475 14:99525325-99525347 GGGCCTATGTGGGGCCACCCTGG + Intronic
1122278300 14:100606516-100606538 GCGCCTCTGTGGTGTCCTCAGGG + Intergenic
1123936862 15:25198263-25198285 GGGGCTCTGGGGTGCCACAGGGG + Intergenic
1124925465 15:34066218-34066240 GGGCCTCCGTGATGCCAACTGGG + Exonic
1125368171 15:38941671-38941693 GGAGCTCTGTGGTGCCCACAGGG - Intergenic
1127817642 15:62625762-62625784 GGGCTTCTGTGTTGCCAGCCTGG + Intronic
1131107223 15:89743515-89743537 GGGCCTCTGCAGAGCCAGCAAGG + Exonic
1132358569 15:101192662-101192684 GCACCTCTGTGGAGCCACGAGGG - Intronic
1132501270 16:285798-285820 GGGCCTCTGCGGGGCCTGCAGGG - Intronic
1133009490 16:2902792-2902814 GGAGCTCAGTGGTGCCATCATGG - Intergenic
1134362624 16:13545774-13545796 GGACCGGTGTGGTGCCATCATGG - Intergenic
1136923081 16:34347034-34347056 GGGCCTCTGCTGTGCTCCCAGGG + Intergenic
1136981492 16:35064772-35064794 GGGCCTCTGCTGTGCTCCCAGGG - Intergenic
1138533651 16:57648399-57648421 AGGGCTCTGTGATGCCACCAGGG + Intronic
1141639956 16:85335285-85335307 CGGCCTCAGCAGTGCCACCATGG - Intergenic
1142214006 16:88822036-88822058 GGGCCTCTGTGTCGCCCCTAAGG + Intronic
1142231189 16:88901028-88901050 CTGCCTCTGTGGTCCCTCCACGG + Intronic
1142247789 16:88977678-88977700 GGCCCTCTGTGGAGACAGCAGGG + Intergenic
1144968108 17:19090328-19090350 GGGCCCCTGTGGTTCCAACCAGG + Intergenic
1144979809 17:19161735-19161757 GGGCCCCTGTGGTTCCAACCAGG - Intergenic
1144988413 17:19216497-19216519 GGGCCCCTGTGGTTCCAACCAGG + Intronic
1145217954 17:21066383-21066405 TGGCCTCAGATGTGCCACCAGGG + Intergenic
1147186311 17:38715180-38715202 GGGCTTCTCTGGTGCCATCCTGG - Intronic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1152276887 17:79363201-79363223 GGGGTTCTGTAGTGCCAGCAAGG + Intronic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1153909565 18:9695172-9695194 GGGGCCCTGTGGTGTCTCCACGG + Intergenic
1154023095 18:10682512-10682534 TGGCCCCTGTGGATCCACCAGGG - Intronic
1157388652 18:47282191-47282213 GGGGCTCAGTGGTGCCATCCAGG + Intergenic
1160040792 18:75343726-75343748 TGGCCTTTCTGGTGACACCAGGG + Intergenic
1160240527 18:77119351-77119373 GGGTCTCTGTCTTGTCACCATGG + Intronic
1160265268 18:77336425-77336447 GGGCCCCTGTGAGGACACCAGGG - Intergenic
1160506300 18:79428436-79428458 TGGCCTTTGTGGTGCCTCCAGGG + Intronic
1162737455 19:12754509-12754531 GGGGCTCAGTGGGGACACCAGGG - Intronic
1166496712 19:43308078-43308100 GGGACGCTGTTGTGTCACCATGG + Intergenic
1167503251 19:49858801-49858823 GGGGCTCTGTGCTGTCCCCACGG + Intronic
1167614721 19:50526134-50526156 GCCCCGCTGTGCTGCCACCAAGG + Intronic
1168291479 19:55359690-55359712 GGGCCTATGGGCTCCCACCAGGG - Exonic
925174355 2:1771813-1771835 GGGCCTCTGGGGTGCAGCCTGGG - Intergenic
926143156 2:10380540-10380562 GGCCCTCTGTGGACACACCATGG - Intronic
926206427 2:10837196-10837218 GGGCCTGTGTGCTGCTCCCATGG + Intronic
929531269 2:42754487-42754509 GGCCAACTGTGATGCCACCAAGG - Exonic
931075864 2:58710849-58710871 GGGACACTGTGCTGCCAGCAAGG - Intergenic
933531438 2:83517305-83517327 GGATCTCTGTGGTGCCAGGAAGG - Intergenic
933738452 2:85513916-85513938 GGGCCTAAGTGGTGTGACCAGGG - Intergenic
934766409 2:96882546-96882568 GTGCCTCTGTAGTGCCAGCCAGG - Intronic
935111453 2:100098339-100098361 GGGCCTCGATTTTGCCACCAAGG + Intronic
936011703 2:108929239-108929261 GGGCCACCGTGCTGACACCAGGG - Exonic
936123515 2:109766823-109766845 GGGCCTCGATTTTGCCACCAAGG - Intergenic
936628922 2:114179043-114179065 TGGCCTCTGAGGTTACACCAAGG + Intergenic
942111159 2:172683971-172683993 GGCCCTCTGTTATGCCTCCAGGG - Intergenic
948167291 2:235872925-235872947 GGGCTTTTGTGGTGGCTCCACGG + Intronic
948466057 2:238152144-238152166 GGGCCTCTGGGGCAACACCAGGG - Exonic
949072491 2:242033998-242034020 TCTCCTCTGTGGTGCCCCCAAGG - Intergenic
1168952338 20:1810996-1811018 GGAGCTCTGTGTTCCCACCAAGG + Intergenic
1170942684 20:20862230-20862252 GGGACTGTGTGTGGCCACCACGG - Intergenic
1171323400 20:24267280-24267302 GGGTCTCTGTGGTAACACCTTGG - Intergenic
1171493373 20:25537814-25537836 GGTGGCCTGTGGTGCCACCATGG - Intronic
1172192512 20:33070556-33070578 GGGCCTCAGTGCTGTCACCATGG + Intronic
1172386135 20:34535408-34535430 GGGGCTCTGTGGTGCAACCAAGG + Intronic
1173727305 20:45306904-45306926 GGGGCCCCGTGGAGCCACCATGG + Exonic
1174083658 20:47989444-47989466 GGTCCTCTGTGTGGCCATCATGG + Intergenic
1175093668 20:56524703-56524725 GGGCCTCTGTGACATCACCAAGG + Exonic
1175094859 20:56533236-56533258 GGGCCTCTGTGACATCACCAAGG + Exonic
1176132753 20:63503164-63503186 GCGCCCCTGTGCTGGCACCAGGG - Intergenic
1179368858 21:40785391-40785413 CTGCCTTTGTGGTCCCACCATGG + Intronic
1179407886 21:41140324-41140346 GGCCCTGTGTGGTGACAGCAGGG + Intergenic
1183245797 22:36692489-36692511 GGTCCTCTGTGGTGCCTCCTGGG - Intronic
1183345999 22:37308172-37308194 GGGCCCCTGAGGAGCCACCAGGG - Intronic
1184775987 22:46623174-46623196 GGTCCTGTGTGGGTCCACCAGGG + Intronic
1185070685 22:48654197-48654219 GGGCCCCTGTGCTGCCAACCAGG + Intronic
1185249097 22:49790178-49790200 GGGCCTCTGTGGTCCCGGCTGGG - Intronic
1185366474 22:50439186-50439208 GTGCCTCAGTGCTGCCCCCAGGG - Intronic
949280527 3:2341610-2341632 GGCACCCTGTGGTGCCACCCTGG + Intronic
953926787 3:46986667-46986689 GGGTCTCTGTGGGGCCACTGAGG + Intronic
954201313 3:49025002-49025024 GGGCCTCAGTGGTGGCAGCCAGG + Exonic
954454582 3:50590833-50590855 GGCCCTTGGTGGTGCCTCCAAGG + Intergenic
959892308 3:111570482-111570504 GGGTCACAGTGGAGCCACCAAGG + Intronic
960997263 3:123348457-123348479 GGGGGTCTGGGGTGCCACTATGG + Intronic
961455761 3:127023127-127023149 GGGCCTCTGAGGGGCCAGCCTGG + Intronic
961490234 3:127252216-127252238 GGTCATCTGTGGTGCCATCTGGG - Intergenic
961822068 3:129580317-129580339 GGGCCTCCGTGTTCCTACCAAGG + Intronic
962427658 3:135286676-135286698 GGGCATCTGTAGCTCCACCATGG - Intergenic
964553455 3:157910552-157910574 TGTCCTCTGTGCTGCTACCAAGG - Intergenic
967945674 3:194802012-194802034 GGGGCTCTGTGGAGGCGCCAGGG + Intergenic
968460779 4:723757-723779 GGGCCTCTGTGAGGCCAGGAGGG + Intronic
968532867 4:1104435-1104457 GGGCTTCTGTGGTGACAGAAGGG + Intronic
968538867 4:1152057-1152079 GGGTCTCAGTGATGACACCACGG - Intergenic
968575874 4:1365922-1365944 GTGCGTCTGTGGTGCCCCCGAGG - Intronic
968881373 4:3301809-3301831 GGACCTCCGAGGTGCCAGCAAGG + Intronic
968902947 4:3439750-3439772 GGGCCTCAGGGGGGCCACCCTGG + Exonic
968929924 4:3573421-3573443 TGGCCTCTGTGCTGCCACTCAGG + Intergenic
969826739 4:9763878-9763900 GGGACTCTGTTGCGCCACCCTGG + Intergenic
973757353 4:54088623-54088645 GGCCCTCCATGATGCCACCATGG - Intronic
977185697 4:93932914-93932936 GGGCCCTTGTGGTGTGACCATGG + Intergenic
981914197 4:150015805-150015827 AGGCCTCTGAGGGGCAACCATGG + Intergenic
985673209 5:1216985-1217007 CGGACTCTGAGGTGCCAGCAAGG - Intronic
985710965 5:1429716-1429738 TGGCCGCAGAGGTGCCACCAGGG - Intronic
985821891 5:2166205-2166227 GGGCCTGAGGGGTGCCAGCATGG + Intergenic
986200323 5:5573300-5573322 GGGCCTCTGTGGATTCTCCAAGG - Intergenic
991949304 5:71932471-71932493 GGGCCTCTGTTATGTCACTAGGG + Intergenic
992642793 5:78783030-78783052 GGGCCCTTGTGGACCCACCAGGG - Intronic
997839523 5:137226482-137226504 TGGCCTCTGTGGGGCTTCCATGG - Intronic
999425374 5:151483709-151483731 GGGTATCTGTTTTGCCACCATGG - Intronic
1000292717 5:159885652-159885674 GTGCCTCAGTGGTGTCATCAAGG - Intergenic
1001288053 5:170437975-170437997 GGGGCTCTGTGGAGGGACCAAGG - Intronic
1001669716 5:173463622-173463644 GTGCCTTTGTGGTCCCACAACGG - Intergenic
1003406381 6:5830043-5830065 GGGCCTCATGGGTCCCACCAGGG - Intergenic
1004907498 6:20250291-20250313 AGGCCACTTTGGTGCCAACAGGG + Intergenic
1005489640 6:26335571-26335593 GGGGCTCTATTGTACCACCAAGG + Intergenic
1006437128 6:34031494-34031516 GGGCCCCAGTGGGGGCACCAGGG + Intronic
1006713849 6:36100868-36100890 GGCCCTCTGTGATGCCAACCTGG - Intronic
1007321814 6:41033231-41033253 GGGCCTCTGTGGGGCCTTCAAGG + Intronic
1007485773 6:42179529-42179551 CTGCCTCTCTGCTGCCACCATGG - Exonic
1008162258 6:48092797-48092819 GGGTCTCAGTGAGGCCACCAAGG + Intergenic
1008749999 6:54721277-54721299 TGGCCTCTTTGGGGCCAGCAGGG + Intergenic
1014375834 6:120671720-120671742 CGGCCTCAGTGCTGCCACTAGGG + Intergenic
1016346816 6:143122797-143122819 GGGAATCTGTGGTGCCAGTAGGG - Intronic
1018745917 6:166762069-166762091 GTACCTCTGTGGTGACACCAGGG - Intronic
1019923831 7:4179706-4179728 GGGCCATGGTGGGGCCACCAAGG + Intronic
1022036536 7:26539873-26539895 GGGCCACTGTGGAGGCAGCAGGG + Intergenic
1025096512 7:56099831-56099853 GGGCTTCTGTGATCCCACCTCGG + Intergenic
1029115679 7:98235918-98235940 GGGCCTCTGGGCTGACAGCACGG + Intronic
1029495299 7:100893197-100893219 GGGCCTCTGGGGTGTCACTGAGG + Exonic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032594699 7:133227953-133227975 GGGAGTCTGTGTTGCCACAAAGG + Intergenic
1034970041 7:155413143-155413165 GGGCTGCTGTGGTGACAACAGGG + Intergenic
1037777954 8:21848097-21848119 GGGCCTCAGTGGAACCAGCAGGG - Intergenic
1038304067 8:26383409-26383431 GGGCCTCTCTGTTGCCTCCTGGG + Intronic
1041372173 8:57173068-57173090 GGCCCTTTGTGGTGTCTCCAAGG + Intergenic
1042128239 8:65560394-65560416 GGGCCTCCGTTGTGCCCCGAAGG + Intergenic
1048456881 8:134586561-134586583 GGCCCTCTGTGCTTCCATCAGGG + Intronic
1049271523 8:141698667-141698689 GGTCCTCTGTGGCTCCACCACGG - Intergenic
1049375773 8:142288385-142288407 GAGACCCTGTGGTGCCCCCAGGG + Intronic
1049582934 8:143420987-143421009 GGGCCACTGTGGGGGCAGCAGGG - Intronic
1052232006 9:26165066-26165088 TGGCCACTTTGGTGCCAGCAGGG - Intergenic
1053543576 9:38999370-38999392 GGGTCTCTGTGGTCCCCTCACGG - Intergenic
1053808008 9:41822875-41822897 GGGTCTCTGTGGTCCCCTCACGG - Intergenic
1054622584 9:67364553-67364575 GGGTCTCTGTGGTCCCCTCACGG + Intergenic
1056766267 9:89446558-89446580 GGGCCTCTCTCGGGCCACCAAGG + Intronic
1057170641 9:92961076-92961098 TGGCCTCTGTGGTCCCACACAGG + Intronic
1057435900 9:95040440-95040462 GTGGCTCTGTGGTGGCCCCAAGG - Intronic
1058439179 9:104991612-104991634 GGCCCTCTGAGCTGCCACCCTGG - Intergenic
1061288418 9:129637365-129637387 CGTCCTGTGCGGTGCCACCAAGG - Exonic
1061507039 9:131037209-131037231 TGGCCTCTGTGTCCCCACCATGG - Intronic
1061892266 9:133629181-133629203 GGGCATCTGTGGTCCTACCCGGG - Intergenic
1061969436 9:134035885-134035907 GGGCATCTGTGGTGGGACGAAGG + Intronic
1061985384 9:134127409-134127431 AGGCCTGTGTGGTGCCTGCAGGG + Intergenic
1062167217 9:135113842-135113864 GAGCCCCTGTGGTGCCCCCCAGG - Intronic
1203793521 EBV:163964-163986 GGCCCTCTGTGGCGAGACCAGGG - Intergenic
1186726693 X:12365719-12365741 GGGCACCTGTCCTGCCACCAGGG + Intronic
1187044117 X:15629104-15629126 ATGCCTCCGTGGTGTCACCATGG - Intronic
1187735157 X:22295586-22295608 GTGCTTCTTTTGTGCCACCAGGG - Intergenic
1188609392 X:32077179-32077201 GGGCCTCTGAGGTATCATCAAGG + Intronic
1189566059 X:42242380-42242402 GGGCCTCTGTAGAGCCGGCATGG - Intergenic
1190328299 X:49220126-49220148 GGACTTCAGTGGTGCCATCATGG + Intronic
1192153176 X:68724437-68724459 GGGCCTGGGTGGTGCCACCCTGG - Exonic
1199696983 X:150349548-150349570 GGGCATCTCTGATGCCAGCATGG - Intergenic
1200238226 X:154479346-154479368 GGGCCTCACTGGGGCCTCCAGGG - Intergenic
1201223041 Y:11789799-11789821 GGGCCTCTGAGGTGCTGCCCAGG + Intergenic