ID: 901808804

View in Genome Browser
Species Human (GRCh38)
Location 1:11754190-11754212
Sequence TAAATGGGAGTTCCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901808804_901808809 29 Left 901808804 1:11754190-11754212 CCTTGCAGAGGAACTCCCATTTA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 901808809 1:11754242-11754264 CACCATCACCAGAACAGTATGGG 0: 1
1: 10
2: 406
3: 3441
4: 9147
901808804_901808808 28 Left 901808804 1:11754190-11754212 CCTTGCAGAGGAACTCCCATTTA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 901808808 1:11754241-11754263 TCACCATCACCAGAACAGTATGG 0: 1
1: 12
2: 489
3: 4406
4: 9876
901808804_901808810 30 Left 901808804 1:11754190-11754212 CCTTGCAGAGGAACTCCCATTTA 0: 1
1: 0
2: 0
3: 16
4: 134
Right 901808810 1:11754243-11754265 ACCATCACCAGAACAGTATGGGG 0: 2
1: 12
2: 331
3: 2669
4: 6374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901808804 Original CRISPR TAAATGGGAGTTCCTCTGCA AGG (reversed) Intronic
901808804 1:11754190-11754212 TAAATGGGAGTTCCTCTGCAAGG - Intronic
902742049 1:18445618-18445640 AAACTCGGAGTTCTTCTGCAAGG + Intergenic
904095468 1:27973424-27973446 GAAATGGGTGCTTCTCTGCAGGG + Exonic
906865732 1:49417504-49417526 TAAACTGGAGTTCTTTTGCAAGG + Intronic
907297992 1:53467806-53467828 TAAATGCATGTTCCTATGCAGGG - Intergenic
908382188 1:63607226-63607248 TAAATGGAACTTCCCCTGCCTGG - Intronic
911059431 1:93734885-93734907 TAAATGTTAGTTCCTCTGAGTGG + Intronic
916360200 1:163959399-163959421 GCAGTGGGAGTTCCTCTGCCTGG + Intergenic
920906851 1:210178621-210178643 TAAATGTGAGATTCTTTGCAAGG - Intergenic
922024850 1:221740748-221740770 TAATTGGGAGGTCCTCTTTACGG - Intronic
923898538 1:238300439-238300461 TAAATGGAAGTTACACTACAGGG + Intergenic
1065444918 10:25788360-25788382 AAAATGTAAGTTCCTCTGGAAGG - Intergenic
1066357356 10:34697963-34697985 TAAATGGTATTTCCTCTTCAAGG + Intronic
1069747154 10:70722851-70722873 TAAACTGGAATTACTCTGCATGG - Intronic
1070974793 10:80597750-80597772 CAAATGCCATTTCCTCTGCAGGG - Intronic
1071815751 10:89231306-89231328 TAAATGACAGTTCTGCTGCAAGG + Intronic
1074043159 10:109812299-109812321 TAAATGGGAATTAATCTGAAGGG - Intergenic
1077634817 11:3835259-3835281 CATATGGGAGTTCCTCTTCCTGG + Intronic
1079157461 11:17961431-17961453 TAAATGACCGTTCCTCTGCTGGG + Intronic
1080140735 11:28916860-28916882 TTAATGGGATTTCCTTTGCAGGG + Intergenic
1080229861 11:30007859-30007881 TGTATGGGAGTTCTTCTGTATGG - Intergenic
1084293093 11:68188904-68188926 TGAATGAGTGGTCCTCTGCATGG - Intronic
1089484939 11:118838011-118838033 TAAATAGGAGTTCCTCTTAAAGG - Intergenic
1090952515 11:131486049-131486071 TAAATGGCGGTTCCTCTGCTTGG - Intronic
1095542981 12:43331949-43331971 TAACTGGGATTTCCACTTCAAGG - Intergenic
1099500453 12:83407496-83407518 TACATGTGAGTTCTTCAGCATGG + Intergenic
1100751496 12:97703102-97703124 TAAATGCGAGGTCCTCACCATGG - Intergenic
1101046632 12:100813295-100813317 CAAATGGGTGATCCTCTCCAAGG + Intronic
1102465644 12:113129553-113129575 TAAAGGGAAGTACCCCTGCAGGG - Intronic
1105531821 13:21227658-21227680 TTACTTGGAATTCCTCTGCATGG + Intergenic
1106089915 13:26581554-26581576 TAAAAGGGAGTTGCTCTGATTGG - Intronic
1107708413 13:43129548-43129570 AAAATGGGAATTCCTTTGGATGG - Intergenic
1111971571 13:94922555-94922577 TAAACTGGAGTTCCTTTGGATGG - Intergenic
1113332186 13:109339869-109339891 TTATTTGGAGTTCTTCTGCATGG + Intergenic
1115012307 14:28564089-28564111 TTATTTGGAATTCCTCTGCATGG - Intergenic
1115434050 14:33353712-33353734 TAAATAGGAAATCCTTTGCAAGG - Intronic
1116704191 14:48275736-48275758 TAAATTTGAGTCCCTTTGCAGGG - Intergenic
1117984225 14:61371853-61371875 TTATTGGGAATTCCTCTGCTTGG + Intronic
1118133890 14:63000132-63000154 TATATGTGAGTTCCTATGCAAGG + Intronic
1118697939 14:68403192-68403214 TAAATGGGCTTTCATCTGCAGGG + Intronic
1119929194 14:78528315-78528337 AAAATGGGAATTCCACTGAAGGG - Intronic
1120176688 14:81301771-81301793 AAAATGGAGTTTCCTCTGCATGG - Intronic
1120933955 14:89875227-89875249 AAAAGGGCAGTTCCCCTGCATGG - Intronic
1121036106 14:90705041-90705063 TAAATGGCAGCTCCTCTGGATGG - Intronic
1122426881 14:101615032-101615054 TTATTTGGAATTCCTCTGCAAGG - Intergenic
1122530437 14:102421766-102421788 GAGATGGGAGTTACTCTGCCTGG + Intronic
1124004097 15:25782851-25782873 TCAATGAGATTTCCTCTCCAAGG - Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1125864969 15:43038059-43038081 TAAATGGGAATTCCTCAGGTGGG + Intronic
1128410963 15:67396527-67396549 TAAATGGGAGAACATCTGCCAGG - Intronic
1131922791 15:97348442-97348464 AAAATGGGAGGTCTTCTGCTTGG - Intergenic
1132342728 15:101088428-101088450 GCGATGGGAGTTCCTCTGTAGGG - Intergenic
1134036158 16:11032853-11032875 AAAATGGCAATTCCTCTTCAGGG - Intronic
1136672293 16:31869536-31869558 AAAATGGAAGTTCCGCTTCATGG - Intergenic
1139914088 16:70417609-70417631 TAATAAGGAGTTTCTCTGCAAGG + Intronic
1140755469 16:78062653-78062675 TAAAAGGAAGTTACTGTGCATGG - Intronic
1143703499 17:8680033-8680055 TAAATGGGTGCTTCTCTGGATGG - Intergenic
1152180022 17:78813660-78813682 TAATTGGGAATTCCACTGGAGGG - Intronic
1155528504 18:26742170-26742192 GGAATGGGAGTTTCTCTTCAGGG + Intergenic
1155698236 18:28710383-28710405 TAAATAGGAGTTACACTGTATGG - Intergenic
1157681878 18:49613760-49613782 TAAATTGCAGTTCCTTTACAGGG + Intergenic
1157700735 18:49760284-49760306 GATATGGGAGTCCCTCTGCGGGG + Intergenic
1157815547 18:50727293-50727315 TAACTGGGAGTCCCACTGCCGGG + Intronic
1158631603 18:59119959-59119981 TTAATGGAAGTTCCACTCCAAGG - Intergenic
1160700667 19:505534-505556 TAAATGTCATTTCCTCAGCAAGG + Intergenic
1167872961 19:52388962-52388984 TAAAGGGCAGTTTCCCTGCACGG - Intergenic
927959299 2:27230691-27230713 TAAATGTGATTTGCTCTGCATGG + Intronic
928031395 2:27782919-27782941 TTATTGGGAGTTCTTCTGCATGG + Intronic
928826088 2:35422946-35422968 TTAATGTGATTTCCTCTGCAAGG - Intergenic
929126780 2:38529565-38529587 TCAACGTGCGTTCCTCTGCAGGG - Intergenic
929503864 2:42513144-42513166 GAAATGGGGTTTCCCCTGCATGG - Intronic
936018399 2:108976576-108976598 TTACCTGGAGTTCCTCTGCACGG + Intronic
939250799 2:139679892-139679914 AAAGTGAGAGTTCCTGTGCAAGG + Intergenic
941129124 2:161624916-161624938 TAAAAGGGGGCTTCTCTGCAAGG - Intronic
944170963 2:196777204-196777226 TAAAGGGCACTTTCTCTGCATGG - Intronic
945335744 2:208591086-208591108 TAAATGAGGGTTCCTAGGCATGG - Intronic
945731407 2:213541013-213541035 TAGAGGGGCTTTCCTCTGCATGG + Intronic
946939748 2:224758455-224758477 TGCATGGTAGTTCCTCTGCTGGG + Intergenic
1169160295 20:3371924-3371946 TACAGGGAAGTTCCTCTGCTAGG - Intronic
1172939838 20:38646472-38646494 AAAATGGGAGTCGCTCTGCGGGG + Intronic
1174499049 20:50970799-50970821 TTAATGGAAGTGCCTCTCCAAGG + Intergenic
1175276802 20:57776532-57776554 TACATGGGACTTTCTCTGCCGGG + Intergenic
1177352714 21:19965140-19965162 GAAATGGGAGTCTCTCTGCCTGG + Intergenic
1180135461 21:45859376-45859398 CATATGGGGGTTCCCCTGCATGG + Intronic
1184963144 22:47946245-47946267 TATATGAGAGCGCCTCTGCAAGG + Intergenic
1185154910 22:49187858-49187880 TAAAGGGCAGTTCCCCTGCACGG - Intergenic
950478453 3:13228854-13228876 TAAATGCTACTTCCTCAGCAAGG + Intergenic
952086297 3:29825549-29825571 TAATGGGGAGTTCCCCTGCACGG + Intronic
957465883 3:80589950-80589972 TTGATGGGATTTCCTCTGTAGGG + Intergenic
958159537 3:89799725-89799747 TTAGTGGGAATTCTTCTGCATGG - Intergenic
959922759 3:111886930-111886952 TAAATAATAGTTGCTCTGCATGG - Intronic
960462852 3:117958331-117958353 TAAATGAGAGTGCCTCTGAAGGG - Intergenic
960526092 3:118712149-118712171 TTAATTGGAATTCCTCTGTAAGG + Intergenic
961974857 3:131012708-131012730 TGCATGGGAGTTCCTCAGTAAGG - Intronic
964580773 3:158234840-158234862 TAACTGTAAGTTCCTATGCATGG + Intronic
965420284 3:168449382-168449404 TAAGTAGGAGTTCCTCAGGAGGG - Intergenic
968431043 4:559023-559045 TAAACTGCAGTTTCTCTGCATGG + Intergenic
969503276 4:7567760-7567782 TTATTTGGAATTCCTCTGCATGG + Intronic
970048514 4:11883789-11883811 TAAATGAGAGTTCCTCTCAGTGG + Intergenic
970271233 4:14350010-14350032 GATATGGGAGTTCCTCTAGAAGG + Intergenic
971561719 4:28085797-28085819 TAAATGTGGGTCCCTTTGCAGGG - Intergenic
971600538 4:28585985-28586007 TAAATGTCATTTCCTCAGCAAGG - Intergenic
972117919 4:35661573-35661595 TAAATACGATTTCTTCTGCAGGG - Intergenic
974281266 4:59797294-59797316 TAAGTGGGAGCTAATCTGCAAGG - Intergenic
975032966 4:69645935-69645957 TGAATGTGAGTTTTTCTGCAAGG - Intronic
985762513 5:1757549-1757571 GAAATGGAAGCTCCACTGCAAGG + Intergenic
986134691 5:4965234-4965256 TTATTTGGAATTCCTCTGCATGG - Intergenic
986301726 5:6482880-6482902 TAGATGAGAGTGCCTCTGCTTGG - Intronic
988157539 5:27474421-27474443 CACATGGGATTTCCTTTGCAAGG - Intergenic
992467618 5:77022650-77022672 AAAATGGGAGTTTTCCTGCACGG + Intergenic
993902037 5:93590935-93590957 TAAATGAGACTTTCTCTGAAAGG + Intronic
995524690 5:113041077-113041099 TAAATGGCAGTTGCTCTGCTTGG - Intronic
997838618 5:137217515-137217537 AAGATGGGATTTCCTCTTCAGGG + Intronic
1002298337 5:178243666-178243688 TCAAGGGGAGTTTCTCAGCACGG + Intronic
1002562456 5:180091455-180091477 TAAATGCAGGTGCCTCTGCAGGG + Intergenic
1004999324 6:21224923-21224945 TAAATGGCAGTTCATATGGAAGG + Intronic
1005121922 6:22399783-22399805 CAAAGGGCAGTTCATCTGCATGG + Intergenic
1006337906 6:33430516-33430538 TAAACTGGAATTCCCCTGCATGG + Intronic
1006430982 6:33995523-33995545 TAAATGGGATTAGATCTGCAAGG + Intergenic
1006821826 6:36902386-36902408 AATAAGGGAGTTCCTCTGCATGG + Exonic
1014814989 6:125925428-125925450 TAAATGTAGGTTCCTTTGCATGG - Intronic
1018776787 6:167024368-167024390 TTAAGGGGAGTTCATCAGCATGG + Intronic
1021388166 7:20058273-20058295 TAAATGGGAGTTAATCTGTGAGG + Intergenic
1022038839 7:26560024-26560046 GAAGTGGAAGTACCTCTGCAAGG + Intergenic
1023619584 7:42056014-42056036 TAGAGGGGAGTTTCCCTGCACGG + Intronic
1023668598 7:42552650-42552672 CAAAAGAGTGTTCCTCTGCAGGG - Intergenic
1028618946 7:92802380-92802402 TAAACTGGAATTCCTTTGCAAGG - Intronic
1030384202 7:108848205-108848227 TATTTGGCGGTTCCTCTGCATGG + Intergenic
1031488323 7:122356604-122356626 TTATTTGGAGTTCTTCTGCATGG + Intronic
1033111787 7:138585884-138585906 TAAATATAAGTTCCTCTGAAAGG + Exonic
1034656718 7:152735677-152735699 GAAATGGGAGTTTCCATGCAAGG - Intergenic
1039084979 8:33770988-33771010 TAAAATGGAATTCCTCTCCATGG - Intergenic
1041488996 8:58411191-58411213 TTAAAGGGAGTTTCTCCGCAGGG - Intergenic
1048748426 8:137643010-137643032 TAAAGGGGACTTTCTCTGAAGGG + Intergenic
1050887811 9:10787319-10787341 TAAATGGTAGTTTATCTGGAAGG + Intergenic
1056910768 9:90698141-90698163 TAAATAGGACTTCCTCTTAATGG - Intergenic
1057659744 9:96990052-96990074 TTATTTGGAATTCCTCTGCATGG - Intronic
1059057737 9:111001985-111002007 TATATGGAAGTTCCTATCCAGGG - Intronic
1061382639 9:130267564-130267586 TAAATGCAAATCCCTCTGCAAGG - Intergenic
1062081788 9:134627967-134627989 TGAATGGAAGTGCCTCTCCAGGG + Intergenic
1062214525 9:135382114-135382136 TATCTGGGAGTGCCTCAGCAGGG + Intergenic
1185872650 X:3676854-3676876 TAAATGGGAGTTTCCCTGCTCGG + Intronic
1186256834 X:7730952-7730974 TGACTGTGTGTTCCTCTGCAAGG + Intergenic
1187507996 X:19892505-19892527 TTAATTGGAATTCCTCTGTAAGG - Intergenic
1187583661 X:20636445-20636467 GAAATGGAAGTACCTGTGCAGGG - Intergenic
1192938510 X:75887254-75887276 TTCATGGGAGTTCCTGTACAAGG - Intergenic
1194392160 X:93332703-93332725 TAAAGGTGAATTCCTCTGCTAGG + Intergenic
1195169211 X:102249487-102249509 TTAATTGGAATTCCTCTGTAAGG + Intergenic
1195189646 X:102437601-102437623 TTAATTGGAATTCCTCTGTAAGG - Intronic
1197820306 X:130534998-130535020 TAAATGGGAAAACCCCTGCATGG + Intergenic
1201983179 Y:19930206-19930228 TAAATGGGAGTTATTATCCAAGG - Intergenic