ID: 901810145

View in Genome Browser
Species Human (GRCh38)
Location 1:11762749-11762771
Sequence GCATTTACAAGCCCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901810140_901810145 26 Left 901810140 1:11762700-11762722 CCTGCTGAAGGCTGCAAGGTGCC 0: 1
1: 0
2: 0
3: 19
4: 188
Right 901810145 1:11762749-11762771 GCATTTACAAGCCCCTGCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 109
901810142_901810145 5 Left 901810142 1:11762721-11762743 CCTAGCACGGTTGTCATTTATTC 0: 1
1: 0
2: 0
3: 9
4: 131
Right 901810145 1:11762749-11762771 GCATTTACAAGCCCCTGCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901810145 Original CRISPR GCATTTACAAGCCCCTGCTG GGG Intronic
900677252 1:3895385-3895407 GCCTTGAGAAGCACCTGCTGCGG - Intronic
901810145 1:11762749-11762771 GCATTTACAAGCCCCTGCTGGGG + Intronic
903847735 1:26288500-26288522 GGCTTCACAAGGCCCTGCTGTGG - Intronic
904083099 1:27884440-27884462 ACAGATAAAAGCCCCTGCTGGGG - Intronic
907321542 1:53605851-53605873 GCATTTCTAAGCACTTGCTGTGG - Intronic
917632969 1:176907976-176907998 CCCTTTACAGGCCCCTACTGAGG + Intronic
919453473 1:197798297-197798319 GCAGTTAAGAACCCCTGCTGGGG + Intergenic
920460340 1:206134860-206134882 GCGTCTTCCAGCCCCTGCTGCGG + Intergenic
920567152 1:206983386-206983408 GCAATTACAGGCACATGCTGAGG - Intergenic
921802888 1:219421428-219421450 CCATTTACAAGCACCTGAGGAGG + Intergenic
1064600025 10:16984323-16984345 GCAATTACAGGCCCTTGCTCTGG + Intronic
1065451715 10:25865586-25865608 ACTTTTAACAGCCCCTGCTGTGG + Intergenic
1076087525 10:127648387-127648409 TGATTTCCAAGCCCATGCTGTGG + Intergenic
1076520423 10:131077731-131077753 GCATTTAATTGCCCCTGCAGCGG - Intergenic
1079150486 11:17894770-17894792 GCATTTACAAGACCCTGGTGAGG - Intronic
1079509616 11:21195844-21195866 GCAATTACCAGCCCTTGCTTCGG - Intronic
1089083517 11:115797624-115797646 GCATTTACAAGCCCCGCTTCAGG - Intergenic
1089097935 11:115935188-115935210 GCAATTAAAAGCTCGTGCTGAGG + Intergenic
1089304515 11:117518087-117518109 GCCCTTACAAGGCCCTGGTGGGG + Intronic
1091213484 11:133884886-133884908 TTATCTATAAGCCCCTGCTGGGG + Intergenic
1094082415 12:26552081-26552103 TCATTTACAAGTCTCTGCTGTGG - Intronic
1095396862 12:41771766-41771788 GCTTTTCCATGCCCCTGCAGAGG + Intergenic
1097154652 12:57003984-57004006 GCAGTTTGAAGACCCTGCTGAGG - Exonic
1101219654 12:102624936-102624958 ACATTTAAAAGCCCCTGCTATGG - Intergenic
1123472828 15:20567732-20567754 GCATTTCCAAGCCCGTGGTTTGG - Intergenic
1123645177 15:22432621-22432643 GCATTTCCAAGCCCGTGGTTTGG + Intergenic
1123666464 15:22612400-22612422 GCATTTCCAAGCCCATGGTCTGG + Intergenic
1123733133 15:23162723-23162745 GCATTTCCAAGCCCGTGGTTTGG - Intergenic
1123751263 15:23360099-23360121 GCATTTCCAAGCCCGTGGTTTGG - Intronic
1124283638 15:28384017-28384039 GCATTTCCAAGCCCGTGGTTTGG - Intronic
1124299061 15:28527596-28527618 GCATTTCCAAGCCCGTGGTTTGG + Intronic
1124320283 15:28706814-28706836 GCATTTCCAAGCCCGTGGTCTGG + Intronic
1124482233 15:30088603-30088625 GCATTTCCAAGCCCGTGGTCTGG - Intronic
1124488692 15:30140705-30140727 GCATTTCCAAGCCCGTGGTCTGG - Intronic
1124543775 15:30609669-30609691 GCATTTCCAAGCCCGTGGTCTGG - Intronic
1124563721 15:30797101-30797123 GCATTTCCAAGCCCATGGTCTGG - Intergenic
1124761344 15:32449973-32449995 GCATTTCCAAGCCCGTGGTCTGG + Intronic
1124777290 15:32599090-32599112 GCATTTCCAAGCCCGTGGTCTGG - Intronic
1124959547 15:34384162-34384184 GCATTTCCAAGCCCGTGGTCTGG + Intronic
1124976173 15:34530383-34530405 GCATTTCCAAGCCCGTGGTCTGG + Intronic
1127360282 15:58239066-58239088 ACATATACATGCCCTTGCTGAGG - Intronic
1127402472 15:58603400-58603422 ACATTTCCAAACACCTGCTGGGG + Intronic
1132286550 15:100667767-100667789 GCATTTCCCAGCCTCTGCTGAGG - Intergenic
1132357267 15:101181051-101181073 GCAGTTACAAGGACCTGCTACGG + Intronic
1135147401 16:19974675-19974697 CCATTCAGAAGCCCCTCCTGTGG + Intergenic
1137344404 16:47641672-47641694 ACTTTCACAAGCTCCTGCTGAGG - Exonic
1139178911 16:64722746-64722768 GCATTTATGAGTCCCTGCTGTGG + Intergenic
1139573151 16:67825782-67825804 GCATTTCAAAGTCCCTCCTGGGG - Exonic
1139734233 16:68973522-68973544 ACATTTAGAAGGCGCTGCTGTGG + Intronic
1143867097 17:9931932-9931954 GCAATTGCAAGTCCCTGCTTTGG - Intronic
1146662712 17:34675263-34675285 TCATGTCCAAGCCCCTGCTCTGG - Intergenic
1147587168 17:41659201-41659223 GCATTACAATGCCCCTGCTGTGG - Intergenic
1151576343 17:74954262-74954284 CCATTCACAAGGCCCTGCAGCGG - Exonic
1151824747 17:76517997-76518019 GCATTGAGAAGCACCAGCTGGGG + Intergenic
1155931591 18:31714513-31714535 GCATTTCCCAGTCCCTGCTTTGG + Intergenic
1156360536 18:36380909-36380931 CCCTTTCTAAGCCCCTGCTGTGG - Intronic
1158042463 18:53112066-53112088 GCATTTAGAAGCCACTACAGGGG + Intronic
1168578004 19:57529269-57529291 GCAGTTTCAAGCCTCCGCTGGGG - Intronic
1168605402 19:57755472-57755494 GCACAGACAAGCTCCTGCTGTGG + Exonic
929011383 2:37448624-37448646 TCATTTGCAAGACCCAGCTGAGG - Intergenic
935361305 2:102248864-102248886 GCCTTTACAAGAACCTTCTGAGG + Intergenic
936980002 2:118255525-118255547 ACATTTACATGGCCCGGCTGTGG - Intergenic
937989006 2:127651947-127651969 GCCATCACAAGCCCCTGCAGAGG - Exonic
947731334 2:232433191-232433213 GTAGTGACAAGGCCCTGCTGTGG + Intergenic
1169769696 20:9187360-9187382 ACATTTGCACACCCCTGCTGAGG + Intronic
1171102562 20:22399315-22399337 GCCTTACCAAGCCCCTGCTATGG - Intergenic
1172957064 20:38768511-38768533 GCTTTTACAAGGCACTGCTGGGG - Intronic
1175372346 20:58500506-58500528 GCATTTCCAAGGACCTGCTATGG - Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1178705777 21:34871683-34871705 GCATCTGCAAGCCCATCCTGTGG + Intronic
1180983658 22:19891540-19891562 GCACTTAGAAGCCCCTGCACTGG + Intronic
1182949985 22:34364559-34364581 GCAGTTAAAAGCACATGCTGTGG - Intergenic
1183137107 22:35899352-35899374 GAATTTACAAGCCCTTCCTGTGG - Intronic
951151923 3:19300480-19300502 GCATATATAAGCTCCTGCTTTGG + Intronic
959857175 3:111173380-111173402 GAGTTTATAAGCCCCTGCAGAGG - Intronic
961654879 3:128435678-128435700 GTTTTTACCAGCCCCTGATGAGG + Intergenic
964537463 3:157739325-157739347 GCATGTATAAGCTCCTCCTGGGG - Intergenic
967667986 3:192197641-192197663 GCCTTTACAAAGCCCTCCTGGGG + Intronic
967943580 3:194784864-194784886 GCTTTTACAAGCCGCTGTTCAGG + Intergenic
969848070 4:9935370-9935392 ACACTTACAACCACCTGCTGTGG + Intronic
970476673 4:16430672-16430694 GCTTTTACAAGCCCAACCTGAGG - Intergenic
975762069 4:77630549-77630571 TCAGTTTCAAGCCCCAGCTGAGG + Intergenic
977255330 4:94733768-94733790 GCACTTAGAAAGCCCTGCTGGGG - Intergenic
985025628 4:185736809-185736831 GATTTTCCAAGTCCCTGCTGAGG - Intronic
985066979 4:186132098-186132120 GCATCACCAAGCCTCTGCTGTGG - Intronic
986952608 5:13108792-13108814 ACATTTACAAGCCCATGTTTTGG + Intergenic
992068738 5:73130261-73130283 GTATGCACAAGCCCCTCCTGGGG - Intronic
999495251 5:152090475-152090497 GCATTTATTAGCACCTACTGTGG + Intergenic
1001893510 5:175359617-175359639 GCTTTTTCCAGTCCCTGCTGAGG + Intergenic
1005471430 6:26165633-26165655 ACATTTCCAAGCCTCAGCTGTGG - Intronic
1012418015 6:99031118-99031140 GCAGTGACAGACCCCTGCTGTGG + Intergenic
1015784542 6:136908544-136908566 TTACTCACAAGCCCCTGCTGTGG - Intronic
1022533946 7:31084319-31084341 GCATTCATGAGCACCTGCTGGGG + Intronic
1022673445 7:32477107-32477129 GCATCTACAATCCCCACCTGTGG + Intergenic
1024526493 7:50354073-50354095 GGATTTAAAAGCCCCAGGTGTGG + Intronic
1030227977 7:107173329-107173351 GCATATAGAAGATCCTGCTGTGG + Intronic
1033525824 7:142212134-142212156 CCATTTACAAGCAAATGCTGAGG + Intronic
1034202446 7:149290961-149290983 GCATTTCCAGGCACCTGCAGGGG + Intronic
1037020129 8:13959916-13959938 GAATTTTCAATCCCCTTCTGTGG + Intergenic
1038211613 8:25523536-25523558 TTATTTATAAGCCCCTGATGGGG - Intergenic
1042594930 8:70436997-70437019 TCATTTACAAGGCCCTGCAAGGG + Intergenic
1045385317 8:101666813-101666835 GCTGTTACAAGACCGTGCTGGGG + Exonic
1046358520 8:113118844-113118866 GCCTTCTCAATCCCCTGCTGCGG - Intronic
1048054419 8:130849716-130849738 ACATTTATAATCCTCTGCTGTGG + Exonic
1048092886 8:131260337-131260359 CAACTTACATGCCCCTGCTGTGG + Intergenic
1048882560 8:138882875-138882897 ACATATACAGGCCCTTGCTGAGG + Intronic
1053000530 9:34574993-34575015 GCATATACAAGCCCATGCCCAGG - Intronic
1054728703 9:68678578-68678600 GCATTTTGCAGCCCTTGCTGGGG - Intergenic
1057849354 9:98552842-98552864 GCTTTTACCACCCCCTGCTGTGG + Intronic
1058096371 9:100865049-100865071 GCATTAAAAAGGCCCAGCTGGGG - Intergenic
1059167666 9:112094386-112094408 CCATTTAAAAGCCCTTGGTGTGG - Intronic
1185724345 X:2407346-2407368 GCTTTGACAAGCTGCTGCTGTGG + Intronic
1187272949 X:17795137-17795159 GAATTTTTGAGCCCCTGCTGTGG + Intergenic
1194594422 X:95839583-95839605 GCATTTTCAAGGCACTACTGGGG + Intergenic
1194666266 X:96680956-96680978 GCATTTAAAAGCCAGTCCTGGGG - Intergenic
1195067015 X:101246819-101246841 GCATTTGCAAGTCACTGCTCTGG + Intronic
1198683764 X:139206502-139206524 TCAATTACAAGAGCCTGCTGTGG + Intronic
1199053961 X:143270480-143270502 GCCTTGACAAGCCAGTGCTGCGG + Intergenic