ID: 901811425

View in Genome Browser
Species Human (GRCh38)
Location 1:11768901-11768923
Sequence GCCCCTGCCTGGTGTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901811418_901811425 21 Left 901811418 1:11768857-11768879 CCACAGGCTGTGGAATCTGATAG 0: 1
1: 0
2: 1
3: 27
4: 247
Right 901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG 0: 1
1: 1
2: 2
3: 33
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901811425 Original CRISPR GCCCCTGCCTGGTGTTCCCT TGG Intronic