ID: 901811425

View in Genome Browser
Species Human (GRCh38)
Location 1:11768901-11768923
Sequence GCCCCTGCCTGGTGTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901811418_901811425 21 Left 901811418 1:11768857-11768879 CCACAGGCTGTGGAATCTGATAG 0: 1
1: 0
2: 1
3: 27
4: 247
Right 901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG 0: 1
1: 1
2: 2
3: 33
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901811425 Original CRISPR GCCCCTGCCTGGTGTTCCCT TGG Intronic
900092263 1:925615-925637 GGCCCGGCCTGCGGTTCCCTCGG + Intronic
900123354 1:1058933-1058955 GCTCCTGCTGGGTGTTGCCTAGG + Intergenic
900316097 1:2057160-2057182 TCACCTGCCCGGTGCTCCCTAGG + Intronic
900537574 1:3186419-3186441 GCCCCTGCGTGGTGGTGCCCCGG + Exonic
900747374 1:4370203-4370225 GATCTTGCCTGATGTTCCCTGGG + Intergenic
900910662 1:5594808-5594830 GCCCCTCCCTGGTGGGGCCTGGG - Intergenic
901056608 1:6451338-6451360 GCCCCTGCCTGGAGGCCCCTGGG - Intronic
901169396 1:7245831-7245853 TGCCCTGACTGGTGTTTCCTGGG - Intronic
901529264 1:9843286-9843308 GCCCCTGCCAGCTTGTCCCTTGG - Intergenic
901811425 1:11768901-11768923 GCCCCTGCCTGGTGTTCCCTTGG + Intronic
902410092 1:16207253-16207275 GCCCCTGCCCGGCTTTTCCTCGG + Intronic
902477757 1:16697168-16697190 GCCCCTGCCTGGAGACCCCTGGG + Intergenic
903554279 1:24181714-24181736 GCCCAGGCCTGGTTTTCCCTGGG + Intronic
904462012 1:30685905-30685927 GCCCCTGCCCTGTCTTCTCTGGG + Intergenic
904655397 1:32041992-32042014 GCCCTTGCTTGGTTTTCCCAGGG + Intronic
904942725 1:34176743-34176765 GCTCCTGCCTGGGGGTCCCCCGG - Intronic
907487342 1:54787054-54787076 GCCCTGGCCTGGTGCTACCTCGG - Exonic
907674801 1:56508605-56508627 GCTCCTTCCTGGCATTCCCTGGG + Intronic
909800845 1:79805949-79805971 GCACCTGCCTGGGCTTCACTTGG + Intergenic
915495546 1:156280217-156280239 GCTCCTGCCTGATGTCCTCTGGG - Intronic
915867788 1:159523455-159523477 GCTCCTTTCTGTTGTTCCCTTGG + Intergenic
916570966 1:166027346-166027368 GCCCCTTCTTGGAGTTCCCCTGG + Intergenic
917714976 1:177725625-177725647 GCCTATGAATGGTGTTCCCTAGG - Intergenic
918754141 1:188315169-188315191 GACCCTGACAGCTGTTCCCTAGG + Intergenic
919741559 1:200984135-200984157 GCCCCTGCCTGCTGTGCCTCAGG - Intronic
919761111 1:201098889-201098911 GCCTCTAACTGGTGCTCCCTGGG + Intronic
920262028 1:204694821-204694843 CCCCCTGACTGGTGTTCCGAAGG + Intergenic
921285794 1:213608181-213608203 GCACCTGCCTGGTGGAGCCTGGG + Intergenic
923934404 1:238745600-238745622 GCCCCTGCCTGGGCTTTCCTTGG - Intergenic
1065468568 10:26052528-26052550 GGCTCTCCCTGGTGTGCCCTAGG - Intronic
1066129395 10:32377523-32377545 GCCTGTCCCTGATGTTCCCTCGG + Intronic
1067081481 10:43215000-43215022 GCCCCTGCCAGGTGCTCTCAGGG - Intronic
1070641435 10:78173199-78173221 TCTCCTGACTGGTGTTTCCTGGG + Intergenic
1070745308 10:78930163-78930185 GCCCCTGCCTGGTGAGCTCATGG - Intergenic
1070806466 10:79273878-79273900 CCTCCTGCCTGGTGCTCCCACGG - Intronic
1071239769 10:83692649-83692671 GCCCCTGTCTGCTGTTAACTGGG + Intergenic
1071576987 10:86734713-86734735 GTCCCTTCCTGATGCTCCCTGGG - Exonic
1075292614 10:121243206-121243228 ATCCCTGCCTGGTGTTACCCGGG + Intergenic
1075465711 10:122648767-122648789 GGCCCGGCCTTGTGTTCTCTTGG - Intergenic
1076544402 10:131235086-131235108 GACCCTGCCTGTGGTACCCTGGG - Intronic
1076610470 10:131722982-131723004 GCTCCTGCCTGGTGGCCCCATGG - Intergenic
1076736774 10:132462521-132462543 GCCCATGCCTTGTTTTACCTGGG + Intergenic
1076807595 10:132866771-132866793 GCCCCTCCATGGTGCTCCCACGG + Intronic
1077189373 11:1249411-1249433 GGCCCAGCCTGGTGTCCCCCTGG + Exonic
1077341079 11:2026637-2026659 GCCCCTGCCTGGGGGTCTATGGG + Intergenic
1080709625 11:34734363-34734385 GTCCCTGCCAGGTGTGCCCATGG - Intergenic
1081526914 11:43933827-43933849 ACTCCACCCTGGTGTTCCCTGGG + Intronic
1081826283 11:46056274-46056296 TCCCCTGCCAGGTGTCCCATGGG - Intronic
1081869393 11:46376440-46376462 GCCCCTACCTGGGATCCCCTAGG - Intronic
1083298743 11:61729115-61729137 GCCCCTGCCCGGTCTCCCCCCGG + Intronic
1083301078 11:61739901-61739923 GCCCTTCCCTGGTGTGCCCCAGG + Intronic
1084891803 11:72240373-72240395 GCCCCTGCCTCCAGATCCCTGGG + Intronic
1084939360 11:72604120-72604142 GCTCCTGCCCAGTGCTCCCTGGG + Intronic
1085264627 11:75229922-75229944 TCCCCTGCATGGTGTCCCGTGGG + Intergenic
1086700437 11:89895613-89895635 GCCTCCGCCTGGTGTTCCTTTGG - Intergenic
1086705732 11:89948913-89948935 GCCTCCGCCTGGTGTTCCTTTGG + Intergenic
1088589847 11:111394156-111394178 CCCCATGCCTAATGTTCCCTGGG - Intronic
1088753284 11:112864200-112864222 GTCTCTGCCTAGTCTTCCCTTGG + Intergenic
1089004431 11:115079063-115079085 GGCCCTTCCTCCTGTTCCCTGGG + Intergenic
1089494951 11:118903148-118903170 GCCCCTGCACGGGGCTCCCTCGG + Intronic
1089615069 11:119690651-119690673 ACCCCGGCCCTGTGTTCCCTTGG + Intronic
1090636841 11:128694734-128694756 GTCCCTGCCTGGTGGGCCCTGGG + Intronic
1202824064 11_KI270721v1_random:81826-81848 GCCCCTGCCTGGGGGTCTATGGG + Intergenic
1091752560 12:3031983-3032005 GCCACTGCCTGCTGTTCCTCAGG - Intronic
1092060844 12:5549037-5549059 GCCCTTCCCTGGTGCTCCTTAGG - Intronic
1094605284 12:31944148-31944170 GCCCCTGATTGGGGTTCCCAGGG + Intergenic
1094830242 12:34296877-34296899 GCCCGTGCCTGGGGTCCCCAGGG + Intergenic
1094830325 12:34297263-34297285 GCCCCTGCCTGGCGTCCTCGGGG + Intergenic
1095307061 12:40651218-40651240 GCCCCTGCCTGGGCCTCACTCGG + Intergenic
1095406988 12:41877754-41877776 TTCCCAGGCTGGTGTTCCCTGGG - Intergenic
1096475186 12:51905330-51905352 GCCCCTGACTGGTGCTCTTTGGG - Intergenic
1096630129 12:52921185-52921207 GCCTCTGCCTGGAGTTCTGTAGG - Intronic
1099600349 12:84727866-84727888 GACACTGCCAAGTGTTCCCTGGG - Intergenic
1101838185 12:108309758-108309780 ACCCCTCCCTATTGTTCCCTGGG + Intronic
1102111012 12:110365938-110365960 GCCCCTCCCTGGCCTCCCCTAGG + Intergenic
1102254311 12:111406910-111406932 CCTCTTGCCTGGGGTTCCCTGGG + Intronic
1102297545 12:111748520-111748542 GCCCCTCAGTGGTGTTTCCTGGG - Intronic
1102459884 12:113093642-113093664 GCCCGTGCCTGGCGTGCCCGGGG + Exonic
1103546172 12:121703207-121703229 GCACCTGCCTGGATCTCCCTGGG + Intergenic
1103742863 12:123103132-123103154 GCCTCTGGTTTGTGTTCCCTGGG + Intronic
1104144325 12:126018330-126018352 GCCCCTGTCAGTTGTTCCTTTGG + Intergenic
1104615430 12:130264285-130264307 GCCCCTGCCAGGAGTAACCTGGG + Intergenic
1104918384 12:132278095-132278117 GCCCCTGCCTACTGTCCCCGGGG - Intronic
1106422610 13:29595886-29595908 GCCCCAACCTGGGGTTCCCGCGG + Intergenic
1107994980 13:45850786-45850808 GCCGCTGCCTGGAGCACCCTAGG - Intronic
1109510549 13:63367233-63367255 GCCCCTGCCTGGGCCTCACTCGG + Intergenic
1113660772 13:112105153-112105175 GGCCCTGCCTGCCGTGCCCTGGG + Intergenic
1113769474 13:112898955-112898977 GGCCCTGCCCGGTGCTCCCTGGG - Intronic
1113839306 13:113349752-113349774 GCCCCTGCCTGGACAGCCCTGGG - Intronic
1113872260 13:113566473-113566495 GGCCCAGCCTGGTGTTGCCACGG + Intergenic
1115518770 14:34212092-34212114 GCCCGTGCCTGCTTTTCACTAGG - Intronic
1117463774 14:55972396-55972418 GCCCCAGCCTGATTTTCCCTGGG + Intergenic
1117882292 14:60323819-60323841 CAGCCAGCCTGGTGTTCCCTGGG + Intergenic
1117983379 14:61363774-61363796 ACTTCTGTCTGGTGTTCCCTTGG - Intronic
1118757862 14:68858341-68858363 GCACCTGCCTGGTAATACCTGGG + Intergenic
1118857971 14:69638784-69638806 GCCCCTGTCTTGCCTTCCCTAGG - Intronic
1119329971 14:73786724-73786746 GCCCCTGCCCGGTGCTTCCCTGG - Intronic
1121233544 14:92376361-92376383 GCCCCTGCCTGGTGCCCCCTTGG + Intronic
1202856302 14_GL000225v1_random:53787-53809 GCCCCGGCCTGGGGTTCCCACGG - Intergenic
1202860569 14_GL000225v1_random:79075-79097 GCCCCGGCTTGGTGCTCCCACGG + Intergenic
1123782935 15:23645234-23645256 GGCCCTGCCTGCAGTTCCATGGG - Exonic
1124407175 15:29403708-29403730 GCCTCTGCCTGGTTTTTCCCAGG + Intronic
1125098127 15:35878227-35878249 AGCCCTGCCTGGTCTTTCCTTGG + Intergenic
1127813258 15:62582684-62582706 CCTCCTGCCTGGCGTGCCCTGGG - Intronic
1128674288 15:69597259-69597281 GGCGCTGCCAGGTGGTCCCTTGG + Intergenic
1128793245 15:70448395-70448417 GCCCCTGCCACGCCTTCCCTGGG + Intergenic
1129446903 15:75625281-75625303 GCCCCCGCCTCGCGTCCCCTGGG + Intronic
1129462229 15:75705127-75705149 GCCCCTGCCTGGCCCTCCCCAGG - Intronic
1129708812 15:77809768-77809790 GCCCCTGCCTCGTTTTGCCAGGG + Intronic
1129722632 15:77886721-77886743 GCCCCTGCCTGGCCCTCCCCAGG + Intergenic
1130952985 15:88606582-88606604 GCACCTGCCTCCTGTTGCCTTGG + Intergenic
1131227682 15:90638826-90638848 GCCCCTGCCTTCTCCTCCCTTGG + Intronic
1131260236 15:90884211-90884233 GCCCCTTCCCGGTGTTCCCGGGG + Intronic
1132083633 15:98888130-98888152 GGAGCTGCCTGGTGTTTCCTGGG - Intronic
1132744382 16:1430629-1430651 GGCCCTGGCTGGGGGTCCCTGGG + Intergenic
1132749218 16:1449659-1449681 GGCCCAGCCTGATGTTCCCGGGG - Intronic
1134220742 16:12351909-12351931 TCCCCTGCCCGCTGTTCCCTTGG - Intronic
1135109306 16:19678282-19678304 GCCCCTGCCAGGTGCTACCTGGG + Intronic
1136552956 16:30991222-30991244 GCCCCTGCCTGGGGCCACCTCGG + Exonic
1137251889 16:46747201-46747223 GCTCCTGCCTGCTGTCCCCCTGG + Intronic
1137578765 16:49621037-49621059 GCCCCTGCCTTGGGCTCCCCGGG - Intronic
1138454944 16:57115787-57115809 GCCCCTGCCTGCCCTCCCCTGGG + Intronic
1141643893 16:85357233-85357255 GGTCCAGCCTGGTGTTCCCTAGG + Intergenic
1141668108 16:85476498-85476520 GCCCATGCCTTCTGTTCCCTGGG + Intergenic
1142118946 16:88376547-88376569 GCCGCTGGCTGGGGTTCCCGCGG + Intergenic
1142342185 16:89530939-89530961 GCACCTGCTTGGTGTCCCCATGG - Intronic
1142590588 17:1003893-1003915 GACCCTGCTGGGTGTTTCCTTGG + Exonic
1143028152 17:3953053-3953075 GCCCCGCCCTGCTGTACCCTAGG - Intronic
1143140982 17:4741669-4741691 GCCCCAGCTTGCGGTTCCCTGGG - Exonic
1143309828 17:5979005-5979027 ACCCCAGCCTGGTGTTCTCTTGG - Intronic
1145279515 17:21457599-21457621 CCCCCTGCCTGGACTGCCCTAGG + Intergenic
1146272230 17:31492032-31492054 GGGCCTGCCTGCTGTTCCCACGG + Intronic
1147563556 17:41522995-41523017 GCCCCTGCCAGGTGGTCTCCTGG - Intergenic
1148109405 17:45136332-45136354 GCCCCTGCCTGGGCTGTCCTGGG + Intronic
1151886563 17:76926245-76926267 GTCCCTCTCTGGTGTCCCCTGGG - Intronic
1152107886 17:78341699-78341721 GCCCTGCCCTGGTGTGCCCTCGG + Intergenic
1152197984 17:78928680-78928702 TCCCCTCCCTGCTGTGCCCTTGG - Intergenic
1152252686 17:79220030-79220052 ACCCCTGCCTGCTGGGCCCTGGG + Intronic
1152408439 17:80110343-80110365 GGCCCTGCCTGGAGGCCCCTGGG - Intergenic
1152600048 17:81257755-81257777 GCCCCTGCCTCATTTTCCCACGG + Intronic
1152676705 17:81645058-81645080 GCCTCCGCCTGGTCCTCCCTGGG - Exonic
1155339507 18:24799594-24799616 GCCCCTGCCTGCCTTTACCTTGG + Intergenic
1156480781 18:37435067-37435089 GCCCCTGTCTGGGCTTCCCTGGG + Intronic
1157283425 18:46360790-46360812 GACCCTGCCTGGTGCTACCTAGG - Intronic
1158108163 18:53908580-53908602 GCCCCTGCTAGGGGTTCCCATGG - Intergenic
1159516188 18:69461397-69461419 GCCCCTGCCAGCTGTTCCCATGG - Intronic
1160871061 19:1278263-1278285 GCCGCTCCCTGCTGTTCCCTCGG - Intronic
1161026719 19:2040372-2040394 GGCCCAGCCTCGGGTTCCCTGGG - Intronic
1161238287 19:3208547-3208569 GCCAGTGCCTGGTGTTTCCTGGG + Exonic
1161469205 19:4447958-4447980 GCTCCTGCGGGGTGCTCCCTCGG + Intronic
1161592236 19:5134085-5134107 GCCCCTGCCTGGGGTTCTCTGGG - Intronic
1162013082 19:7829900-7829922 GCGTCTGCCTGGTGTTCCTCAGG + Intergenic
1162155722 19:8677059-8677081 GCCCCTGACTGGTGGGCCCCGGG + Intergenic
1162156098 19:8678984-8679006 CCCCCTTCTTGGTGTCCCCTGGG + Intergenic
1162830688 19:13282427-13282449 GCCCTTGCCTGTTGGTGCCTCGG + Intronic
1162840934 19:13355934-13355956 GCCACTGCCAAGTGTCCCCTGGG + Intronic
1162910713 19:13846758-13846780 GCCCCTGCCTCCTGTTGCCCTGG + Intergenic
1163320375 19:16571494-16571516 GTCCCTGCCCGGGGTTACCTTGG + Exonic
1164756584 19:30694493-30694515 GCGCCTGGCTGGTGATGCCTGGG + Intronic
1165050606 19:33139196-33139218 GCCCCTGCCTGCTGCACCTTGGG - Intronic
1165224099 19:34342032-34342054 GCCCCAGCCTGGGGTGCCCGTGG - Exonic
1167216033 19:48165277-48165299 GACGCTGCCAGATGTTCCCTGGG + Intronic
1167593412 19:50416062-50416084 TCCCCAGCCGGGGGTTCCCTTGG + Intronic
1168045708 19:53792824-53792846 CCCCCTGCCTGGAATTCACTGGG - Intergenic
1202711774 1_KI270714v1_random:22994-23016 GCCCCTGCCTGGAGACCCCTGGG + Intergenic
925167777 2:1728973-1728995 CGCCCTGCCTGCTGTTCCCCGGG - Intronic
926596752 2:14797797-14797819 GCCCCTGCCTGGGCCTCGCTCGG - Intergenic
926801543 2:16664823-16664845 GACCCTGTCTTGGGTTCCCTGGG + Intronic
928945807 2:36770857-36770879 TCCCCTCCCTGGTCTACCCTTGG - Intronic
929811567 2:45193261-45193283 CTCCCTGCCTCGGGTTCCCTGGG - Intergenic
930512198 2:52359268-52359290 CCCCCTGCCTGGGGCTCACTTGG + Intergenic
932011737 2:67984829-67984851 GCTCCTGCCTGGCTTTCTCTTGG + Intergenic
932025470 2:68127690-68127712 GCTTCTGCCTGGTCTTCTCTTGG + Intronic
934078897 2:88451586-88451608 ACCCCTGGGTGGTGTTCCTTAGG - Intronic
943493077 2:188581117-188581139 GCCCCTGAGTGGAGTTGCCTGGG - Intronic
947435434 2:230068442-230068464 GCCCCTTCCCGGGGGTCCCTGGG + Intronic
948310403 2:236981527-236981549 GCCCGTGGCTGGTGTTTCCTAGG - Intergenic
948524983 2:238566078-238566100 GCCCCTGCCTGGTGTATGCGGGG + Intergenic
948590574 2:239047184-239047206 GTCCCTGTCTCGTCTTCCCTGGG - Intergenic
948722023 2:239906446-239906468 GCCCCCGTCTGGTGTTCTCAAGG - Intronic
1169048650 20:2558501-2558523 GCGCCTGCCTGGGGTCCCCTCGG - Exonic
1170209420 20:13833865-13833887 GCCCAAGGCTGGTGTTTCCTGGG - Intergenic
1174108789 20:48183360-48183382 ACACCTGCCTGGTCTTCTCTTGG + Intergenic
1175748881 20:61481169-61481191 GACCCTACCACGTGTTCCCTGGG - Intronic
1175792638 20:61751310-61751332 GCCACTGCCAAATGTTCCCTGGG + Intronic
1176057008 20:63154380-63154402 GGCCCTGCACGGTGGTCCCTGGG - Intergenic
1176113438 20:63421062-63421084 GCCCCTGCCTGGAGGGCCCCAGG + Intronic
1176135025 20:63518761-63518783 GACGCTGCATGGTGTTCCCGGGG - Intergenic
1176137891 20:63532878-63532900 GCCCCAGCCTGGCGTACCCACGG + Intronic
1176168458 20:63686513-63686535 GCCCCTGCCTTGTGCTCCAGTGG + Intronic
1177101985 21:16909223-16909245 GCCCCATTCTGGTGTTGCCTTGG - Intergenic
1178233336 21:30812822-30812844 TCCCCTGGCTGATGTTCTCTGGG - Exonic
1179172167 21:38981180-38981202 CCCCCTGCCTTGTGTGCCTTGGG - Intergenic
1179569259 21:42268433-42268455 GCCTCTGGCTGGTGTTTCCTGGG + Intronic
1179984274 21:44912372-44912394 GCCCCTGGTGGGTGTTCCGTTGG - Intronic
1180050412 21:45328561-45328583 GCCCCTGCCCTGTGTTAGCTAGG + Intergenic
1180825183 22:18856672-18856694 TCCCCTGCCTTGGGCTCCCTGGG - Intronic
1180935459 22:19622448-19622470 GCCTCTGCCTGGACTTCTCTCGG - Intergenic
1181187547 22:21117875-21117897 TCCCCTGCCTTGGGCTCCCTGGG + Intergenic
1181211651 22:21292618-21292640 TCCCCTGCCTTGGGCTCCCTGGG - Intergenic
1181397856 22:22634268-22634290 TCCCCTGCCTTGGGCTCCCTGGG + Intergenic
1181651551 22:24261790-24261812 TCCCCTGCCTTGGGCTCCCTGGG - Intergenic
1181705824 22:24648949-24648971 TCCCCTGCCTTGGGCTCCCTGGG + Intergenic
1181921871 22:26326971-26326993 GCCCCTGTGTGGAGTTTCCTGGG + Intronic
1182745699 22:32603998-32604020 GCCTATGCTGGGTGTTCCCTTGG + Intronic
1183483765 22:38078489-38078511 GCCCCTGCCTGTTGTTGCAGAGG - Exonic
1183899808 22:40996505-40996527 TCCCCTGCCTGGGGTTTGCTCGG - Intergenic
1184495697 22:44840021-44840043 TCCCCAGCCTGATGTTCCCACGG + Intronic
1184566284 22:45294013-45294035 TCCCCTGCCTGGTCTTCCCAGGG - Intronic
1184642570 22:45880249-45880271 CCCCCTCCCTGCTGTTCCCAGGG - Intergenic
1184981817 22:48100648-48100670 GCCCCTCCCTGGATCTCCCTGGG + Intergenic
1185010632 22:48310968-48310990 GCCCCAGCCACGTGTTCCCCTGG - Intergenic
1185242515 22:49754323-49754345 GAGCCTGCCTGGCGCTCCCTTGG + Intergenic
1185292927 22:50036134-50036156 ACCCCTGGCAGGTGTGCCCTGGG - Intronic
1185322382 22:50207748-50207770 GACCTTGCCTGATGTCCCCTGGG + Intronic
1185419606 22:50728178-50728200 GCCCCTCCCTCCTGTGCCCTGGG + Intergenic
1203215302 22_KI270731v1_random:2814-2836 TCCCCTGCCTTGGGCTCCCTGGG + Intergenic
1203275328 22_KI270734v1_random:82575-82597 TCCCCTGCCTTGGGCTCCCTGGG - Intergenic
949855620 3:8458444-8458466 GCTCCTGCCTGGTTTTTCTTTGG + Intergenic
949932315 3:9088597-9088619 GACATTGCCAGGTGTTCCCTGGG + Intronic
950147633 3:10663360-10663382 GTCCCTGGCTGGTGTCCCCTGGG - Intronic
950369220 3:12514031-12514053 GAAACTGCCTGCTGTTCCCTTGG - Intronic
950440600 3:13008057-13008079 GCCCCTCCCTGGGGTTCCTGGGG - Intronic
952900959 3:38111544-38111566 GGCCCTGCCTGCTCTTCCCAGGG - Intronic
953406651 3:42663156-42663178 GCCCCTCCCAGGTGACCCCTCGG - Intronic
953928152 3:46992747-46992769 TCCCCTGCCTGGTGTTTGATTGG + Intronic
955146106 3:56321521-56321543 GCCTCCCCCTTGTGTTCCCTTGG - Intronic
955768975 3:62371387-62371409 GTCCCTTCCAGGTGTTCCCGAGG - Intronic
955940787 3:64145746-64145768 GCCCCAGCGTGGTGCTGCCTGGG - Intronic
960136884 3:114114512-114114534 GCCCTTGCCAGTTGTTCACTTGG - Intergenic
960810407 3:121622543-121622565 TCCACTGCCTTGTGTTCACTTGG - Exonic
960994741 3:123333423-123333445 GGCCCGGCCTGGAGCTCCCTGGG + Intronic
961326732 3:126113395-126113417 ACTCCTGCCAGGAGTTCCCTGGG - Intronic
962677783 3:137769181-137769203 TCCTCTGCTGGGTGTTCCCTAGG + Intergenic
962940748 3:140122711-140122733 GGGCCTGCCTCCTGTTCCCTTGG + Intronic
963277993 3:143352022-143352044 GCACCTGCCTGGGGTACTCTGGG + Intronic
965729893 3:171760689-171760711 TACCCTGCCAGGTGCTCCCTTGG - Intronic
968008768 3:195259890-195259912 GCTCCTGCCTGGTCCTCCCCGGG - Intronic
968085059 3:195870492-195870514 GCCGCTGCCTGGTGTGGGCTGGG - Intronic
968730042 4:2265233-2265255 GCCCCTGCCTGGGGTGGGCTGGG - Intergenic
968887060 4:3340735-3340757 GCACCTGCCTGCTGCTCCCATGG - Intronic
969527535 4:7711524-7711546 GGCCCAGCCTGCTCTTCCCTGGG - Intronic
969615748 4:8251711-8251733 GCCCCTGCCTGCTGACCCCCAGG - Intergenic
970967604 4:21947076-21947098 GCTCCAGCCTTGAGTTCCCTGGG + Intronic
974707515 4:65540677-65540699 ACCCCTGGCTGGTTTTACCTAGG + Intronic
979896106 4:126159149-126159171 CCTTCTGACTGGTGTTCCCTTGG - Intergenic
984624388 4:181989166-181989188 GCCCCTGCCTTCTGTTCCCCTGG - Intergenic
985823740 5:2178313-2178335 GGCCCTGCGTGGTGCTCGCTGGG + Intergenic
985903206 5:2813438-2813460 GAACCTGCCTGCTCTTCCCTTGG + Intergenic
986098451 5:4583432-4583454 GCTCCTGCTTGGTGTTCACAGGG - Intergenic
986290445 5:6395288-6395310 TCCCCTGCCTTGTGCTGCCTCGG - Intergenic
986517115 5:8575397-8575419 TCCCTTGCCTGGTCTTCGCTAGG - Intergenic
987053095 5:14164965-14164987 GCCCTTGCCAGGTGGTCCTTGGG + Intronic
988785871 5:34565043-34565065 CAGCCTGCCTGGTGTTCCTTTGG + Intergenic
990376161 5:55173170-55173192 GCCGCTGCAAGGTGTTCCCCAGG + Intronic
991020769 5:61977783-61977805 GGCACTGACTGGTGCTCCCTAGG + Intergenic
991300587 5:65125654-65125676 TCCCCTGCCTTGTGTTCACATGG + Intergenic
993386499 5:87268385-87268407 GCCCGGGCCTGGTGGCCCCTGGG + Exonic
997413650 5:133708630-133708652 ACCCCGGCCATGTGTTCCCTAGG + Intergenic
998007167 5:138664812-138664834 GCCCCTGCCTGCTGCTTCCTGGG + Intronic
998079226 5:139260827-139260849 GACCCTACGTGATGTTCCCTTGG + Intronic
999393959 5:151214723-151214745 GCCCCTGACTTGTGTGCTCTGGG - Intronic
1000328219 5:160188131-160188153 GCCCCTGCCTGCTTTTCTCCCGG - Intronic
1002181040 5:177431312-177431334 GCCCCAGCCTGGGGGTCCCAAGG - Intronic
1002192062 5:177483512-177483534 GCCCGAGCCTGGGGCTCCCTGGG - Exonic
1003378689 6:5603024-5603046 GGCCCTGACTGGTGTGCCGTGGG - Intronic
1003566748 6:7229152-7229174 GCCCCTGCCTGGTGACGCCCTGG + Exonic
1004265244 6:14143804-14143826 GCCCCTCCCAGGATTTCCCTGGG + Intergenic
1006456407 6:34134482-34134504 GCTCCTCCCTGGCCTTCCCTTGG - Intronic
1006655019 6:35583585-35583607 AGACCTGCCAGGTGTTCCCTGGG - Intronic
1007092110 6:39190881-39190903 GGCCCTGCCTCATGTGCCCTTGG + Exonic
1007734188 6:43970473-43970495 CTGCCTGCCTGGTGTTCCCAGGG - Intergenic
1012418479 6:99035901-99035923 GCCACAGCCTGGAGTTCCCCTGG - Intergenic
1012997959 6:105992561-105992583 GCCCCTCCCTGGCGCTCACTCGG - Intergenic
1016010856 6:139135854-139135876 GCCCCTGCCCGGTGTCCGCGCGG + Intronic
1016062472 6:139645057-139645079 CTCCCTTCCTTGTGTTCCCTGGG - Intergenic
1017540677 6:155399359-155399381 GCTGCTGCCTGGTGTTCTCCTGG + Intronic
1017611289 6:156188999-156189021 GACCCTCCATGGTGTACCCTCGG + Intergenic
1017738099 6:157381586-157381608 GCCGCCGCCTCGTGTCCCCTCGG + Exonic
1019427577 7:984674-984696 GCTCCTGCCTGCTCTTCCCCAGG - Intronic
1019610103 7:1932198-1932220 GCCCCTGCCAGCTGCTCCCCAGG + Intronic
1019610121 7:1932271-1932293 GCCCCTGCCGGCTGCTCCCCAGG + Intronic
1020097568 7:5377267-5377289 GCTCCTGCCTGCCGTTTCCTGGG - Intronic
1020136590 7:5591570-5591592 GCCCCTGGCTGGGATTGCCTGGG + Intergenic
1021044537 7:15906556-15906578 GGCCCTGCCTGGTTCTCACTAGG + Intergenic
1021176881 7:17459613-17459635 GACCCAGCCTGGTGTGTCCTGGG - Intergenic
1021731469 7:23599314-23599336 CCAACTGCCTGGTTTTCCCTGGG + Intronic
1022505371 7:30906144-30906166 GCCTCTGCCTGGAGTGGCCTCGG - Intergenic
1022706887 7:32810270-32810292 GCCCCTGCCTGGCACTCACTTGG + Intergenic
1026153136 7:67804775-67804797 GCCCCTGGCTGAGGTTCCTTTGG + Intergenic
1026850012 7:73718523-73718545 AGCCCTGCCTGCTGATCCCTGGG - Intronic
1026982999 7:74537668-74537690 GCCTCTCCCTGCAGTTCCCTGGG + Intronic
1028755294 7:94427121-94427143 GCCCCAGGCTGCTGCTCCCTTGG + Intronic
1029473056 7:100766702-100766724 CACCTTGCCTGGTGTTGCCTGGG - Intronic
1029711732 7:102303626-102303648 GCCCCTGCCTTTAATTCCCTGGG + Intronic
1030898877 7:115097027-115097049 GCCTCTGAGTGGTGGTCCCTGGG + Intergenic
1031144449 7:117981949-117981971 GCTCCTGCCTTGTGTTGACTGGG + Intergenic
1032068606 7:128790916-128790938 ACCCCTGCCCGGTGGCCCCTCGG - Intronic
1033298616 7:140164463-140164485 GACATTGACTGGTGTTCCCTGGG + Intronic
1033304543 7:140214803-140214825 GCCCTTCCCAGGTGTTCCCCTGG - Intergenic
1034610893 7:152367351-152367373 GCCCCTGGTAGGTGCTCCCTGGG - Intronic
1034673699 7:152876500-152876522 TCTCCTGCCTGGTGTGCCCCTGG - Intergenic
1035042238 7:155937463-155937485 ACCCCTGACTGCTTTTCCCTGGG - Intergenic
1035359298 7:158299806-158299828 GCACCTGCCAGGGCTTCCCTGGG - Intronic
1037297204 8:17413524-17413546 GCCTCTGCCTGGGGTTGCCGGGG + Intronic
1037329239 8:17727356-17727378 CCACCTGCCCAGTGTTCCCTCGG + Intronic
1037459748 8:19097141-19097163 GCCCCTGCCTGGACCTCCCGAGG + Intergenic
1037920921 8:22804898-22804920 GCTCCTTCCTGCTGTTCCCTCGG + Intronic
1038789725 8:30657916-30657938 GCCCCGGCTTGCTGTTCCCTGGG - Intronic
1040565662 8:48564668-48564690 GCCCCTGCCAGTGGTTCCCCTGG + Intergenic
1040958580 8:53006055-53006077 GCCCCTGCCTGGCCCTTCCTTGG - Intergenic
1045005406 8:97912972-97912994 GCTCTTGCGTGGTGGTCCCTGGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049064521 8:140302276-140302298 GCACCTGCTGGGTGTGCCCTTGG - Intronic
1049554193 8:143274087-143274109 GCCCAAGCCTGGTGTGCCCAGGG + Intronic
1049719891 8:144110944-144110966 GCCTCTGCCTGGTGTCCCACAGG + Exonic
1051367533 9:16331805-16331827 GCCCCGGCCTGGGGTGCCCAGGG + Intergenic
1057207474 9:93182364-93182386 GTCCCATCCTGGTTTTCCCTTGG + Intergenic
1057565658 9:96164117-96164139 GCCCCTCCCTGGTGTCCCAGAGG + Intergenic
1059196944 9:112379658-112379680 GCCCGAGCCTGGCGTTCTCTCGG - Intergenic
1059516786 9:114903286-114903308 GTCCCAGCCTGGTTTTCCCTGGG + Exonic
1060111714 9:120911318-120911340 GCCCCTGGGAGGTGTTACCTGGG + Exonic
1061422530 9:130480028-130480050 GCCCCGGCCTAATGATCCCTTGG - Intronic
1061500504 9:130998790-130998812 GTCCCGGCCTGGTGTCCCCGTGG - Intergenic
1061629968 9:131866125-131866147 TCCCCAGCCTGCTGTTCCCTGGG + Intronic
1061728336 9:132593996-132594018 GCCCCTGCATTGTGTTTTCTGGG - Exonic
1062196516 9:135277063-135277085 GCCCCTTGCTGGTGTTTCTTTGG - Intergenic
1062350695 9:136137309-136137331 GCCCCTGCCTGGTCTGCAGTGGG - Intergenic
1185893199 X:3837984-3838006 GTCACCGCCTCGTGTTCCCTTGG - Intronic
1185898311 X:3876406-3876428 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1185903426 X:3914835-3914857 GTCACCGCCTCGTGTTCCCTTGG - Intergenic
1186753612 X:12647249-12647271 GTCTCTGGCTGGTGTTTCCTGGG - Intronic
1188979722 X:36716189-36716211 TCTCCTGCCTAGTCTTCCCTAGG - Intergenic
1189320732 X:40085688-40085710 GCACCTGCCTGGTCCTCCTTGGG - Intronic
1189479506 X:41381841-41381863 GCCACTGCCTGGTGTTCCCTCGG + Intergenic
1189581859 X:42414675-42414697 TCCCTTGACTGGGGTTCCCTTGG + Intergenic
1197700548 X:129596350-129596372 GCTCCTGCCTGGGGTTCCTCAGG - Intergenic
1197968944 X:132094743-132094765 GCTTCTGCCTGTTATTCCCTTGG + Intronic
1199703856 X:150406684-150406706 GCCTCTGCCTGAATTTCCCTTGG - Intronic
1201414658 Y:13736067-13736089 GCCCTGGCCTGGTGTCCACTTGG - Intergenic