ID: 901811742

View in Genome Browser
Species Human (GRCh38)
Location 1:11771345-11771367
Sequence ATTTAAAAGCTATTGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901811742_901811750 11 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811750 1:11771379-11771401 TAAACTGTCCAGAAGAGGGTAGG 0: 1
1: 0
2: 1
3: 14
4: 166
901811742_901811752 13 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811752 1:11771381-11771403 AACTGTCCAGAAGAGGGTAGGGG 0: 1
1: 0
2: 0
3: 21
4: 194
901811742_901811753 14 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811753 1:11771382-11771404 ACTGTCCAGAAGAGGGTAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 198
901811742_901811749 7 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811749 1:11771375-11771397 AAAATAAACTGTCCAGAAGAGGG 0: 1
1: 0
2: 1
3: 39
4: 466
901811742_901811751 12 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811751 1:11771380-11771402 AAACTGTCCAGAAGAGGGTAGGG 0: 1
1: 0
2: 2
3: 24
4: 176
901811742_901811748 6 Left 901811742 1:11771345-11771367 CCCCCCAGCAATAGCTTTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 238
Right 901811748 1:11771374-11771396 TAAAATAAACTGTCCAGAAGAGG 0: 1
1: 0
2: 6
3: 69
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901811742 Original CRISPR ATTTAAAAGCTATTGCTGGG GGG (reversed) Intronic
900277304 1:1839548-1839570 ATTTAAAAACTAATGCAGGCCGG + Intronic
900807373 1:4776344-4776366 TTGTAAAAGGAATTGCTGGGAGG - Intronic
901524658 1:9812548-9812570 TTTAAAAACCTATTGCTGGCTGG + Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
902655337 1:17864002-17864024 ATTGAAAAGCTCTTGCTGTATGG - Intergenic
905781166 1:40711059-40711081 ATTTAGAATTTTTTGCTGGGGGG - Intronic
905853617 1:41292535-41292557 ATATATTAGCTATTGCTGTGGGG + Intergenic
905930955 1:41787313-41787335 ATTTAAAAGCTAAAGCAGTGAGG - Intronic
906024568 1:42662253-42662275 AGTTAAAAGCAATTGCTGGTAGG + Intronic
906161052 1:43649531-43649553 ATTAAAAAGCAATTCCTGGCCGG - Intergenic
907123358 1:52027084-52027106 ATCTAACATCTATTTCTGGGAGG - Intronic
907202656 1:52741003-52741025 AAATAAAAGTTTTTGCTGGGCGG + Intronic
907834117 1:58093151-58093173 ATTGAACAGATATTGCTGAGTGG - Intronic
908177829 1:61573233-61573255 AGTTAAAAGCAATTGCTGCAAGG - Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909905746 1:81192204-81192226 TTTTAAAAGCTATTTCAGGCCGG - Intergenic
910006588 1:82404508-82404530 ATTTTAAAGCTCTTGTTGGTGGG + Intergenic
910489420 1:87752412-87752434 ATTTAAAACATATTTCTAGGAGG - Intergenic
910684062 1:89898235-89898257 ATCTAAAAGCAATTCATGGGAGG + Intronic
911328716 1:96500475-96500497 ATATAAAACCTAGTGCTGGCAGG - Intergenic
912343383 1:108940236-108940258 ATTTAAAACTCATTGGTGGGTGG - Intronic
912526220 1:110285072-110285094 CTTTAAAGCCTATTGCTGAGTGG + Intergenic
912769483 1:112450445-112450467 ATTTAAAAGGTATCAGTGGGTGG + Intronic
912789273 1:112635733-112635755 TTTTAAAAGCTAGTGATGGCTGG + Intronic
914794963 1:150912506-150912528 ATTTCAAATCTCTTGCTTGGGGG - Intergenic
914914743 1:151812592-151812614 CTTTAAAAACTATTGCTGCCTGG - Intronic
915201586 1:154233621-154233643 ATTTAAAAGATCAGGCTGGGTGG - Intronic
918649407 1:186942243-186942265 AGATAATAGCTATGGCTGGGGGG - Intronic
919730469 1:200910735-200910757 ATATAAAATCTATTGCTGTGTGG - Intronic
921883634 1:220281135-220281157 ATTAAAAAGCTATGGGTTGGGGG - Intergenic
923703408 1:236321716-236321738 ATTTAAAAACTACAGCTGAGGGG + Intergenic
924835828 1:247646213-247646235 ATTTATAAGCTTTGGCTGGAGGG + Intergenic
1064549510 10:16484641-16484663 ATTTTAAAGCTAATGGTGGAGGG + Exonic
1064911872 10:20410738-20410760 ATTTGAAATCTATGGCCGGGCGG - Intergenic
1065420949 10:25543415-25543437 TTTTAAAAAGTATTGCTGGCTGG - Intronic
1069025907 10:63541319-63541341 CTTTAAAAGTTATTTCTAGGAGG + Intronic
1069455793 10:68552805-68552827 TTTTAAAACCTATTGCTGGCTGG + Intergenic
1070386007 10:75925222-75925244 ATTCAAAACCTAATGCTGAGAGG - Intronic
1071895914 10:90066758-90066780 ATCTGAAATATATTGCTGGGAGG + Intergenic
1073443400 10:103565947-103565969 ATTTAAAAGCTACAACTGGCTGG - Intronic
1074959839 10:118433225-118433247 ATATTAAAGCTAGAGCTGGGTGG - Intergenic
1075154125 10:119959776-119959798 ATTCAAAGGCTATTCCTGGCCGG - Intergenic
1075843776 10:125528403-125528425 ATTTAAAAAGTATTTCTGGCCGG - Intergenic
1075987613 10:126801000-126801022 CTTTAAAAACTATTGTTGGTTGG + Intergenic
1077952811 11:6979809-6979831 TTTTAAAATATATTGCTGAGAGG + Intronic
1078153951 11:8782588-8782610 TTTTAAAAGATATTGTTGGCCGG + Intronic
1081417229 11:42830476-42830498 ATTTAAAACCTGCTGCTTGGTGG + Intergenic
1081910478 11:46696888-46696910 AAATAAAAGCTATGGCTGAGGGG + Intronic
1081959985 11:47128925-47128947 ATTTTAAATTTATTTCTGGGGGG - Intronic
1086357219 11:86015436-86015458 AATTAAAAGCCATTGCTGTTGGG - Intronic
1088472795 11:110204296-110204318 ATTTGAAAACTATTTCTGGCTGG - Intronic
1091864571 12:3820250-3820272 ATTTGAAAACTATTGCTGGATGG + Intronic
1097108886 12:56643115-56643137 ATTTGAAAGCTAATTTTGGGAGG - Intronic
1097160344 12:57041933-57041955 ATTTAGAAGCTATTACTGAAAGG - Intronic
1097804619 12:63951792-63951814 ATTTAAAAGCTCTTGCTGTTAGG + Intronic
1099074021 12:78082584-78082606 ATTGAAATGCTAATGGTGGGGGG - Intronic
1100843003 12:98632148-98632170 AATTAAAAGCTATTGAAGGCCGG - Intronic
1101542000 12:105673719-105673741 ATTTAAAAGAGAATGCTGGCCGG - Intergenic
1101684682 12:107006938-107006960 ATTTAAAAACAATTACTGGCTGG - Intronic
1102090360 12:110182246-110182268 CTATAGAAGCTATAGCTGGGTGG - Intronic
1103005591 12:117417815-117417837 ATTTAAGAGCTACTGCTCTGCGG + Intronic
1103983182 12:124750076-124750098 ATTCAAAGGCCATTGCCGGGGGG - Intergenic
1104047801 12:125175285-125175307 ATTTAAAAACACTTCCTGGGAGG - Intergenic
1106516517 13:30459755-30459777 ATTTAAAAGGTACTGCTAAGAGG + Exonic
1106916254 13:34518411-34518433 ATTTATAAGCATTTGTTGGGGGG - Intergenic
1107611425 13:42117500-42117522 ATTAAAAAGATTTAGCTGGGAGG - Intronic
1110545843 13:76754508-76754530 ATGTAAGAACTCTTGCTGGGTGG - Intergenic
1112201214 13:97277228-97277250 AGTTAACCGCTAATGCTGGGGGG + Intronic
1112679368 13:101744647-101744669 ATTTAAAAGCTATTTCTTTTAGG - Intronic
1113067310 13:106385375-106385397 AATTAAACGCTATTGCAAGGTGG + Intergenic
1115453600 14:33576529-33576551 TTTAAAAAGCTACTGCTTGGTGG + Intronic
1115796021 14:36936449-36936471 CTTTGAAAGCTAATGCAGGGTGG - Intronic
1118419032 14:65578915-65578937 ATGCAAAAGCTGTTGCTTGGCGG + Intronic
1118455551 14:65942968-65942990 GTTTAAAAGCTATTCCTGAGAGG - Intergenic
1118613093 14:67556573-67556595 ATTTAAAAGCTGGTGCAGGGTGG - Intronic
1118791481 14:69097371-69097393 ATTTTAAAGCTATTGTTCTGAGG - Intronic
1120051372 14:79870677-79870699 TTATAAAAGCTATTGCCGGCCGG - Intergenic
1120656853 14:87200736-87200758 ATATAACAGCTAGTGTTGGGGGG - Intergenic
1122697787 14:103565254-103565276 AATTAAAAGCTGGTGCTGGCTGG - Intronic
1202839784 14_GL000009v2_random:111105-111127 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202909162 14_GL000194v1_random:101245-101267 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202884105 14_KI270722v1_random:87972-87994 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1127868467 15:63050215-63050237 CTTTAAGACCTCTTGCTGGGTGG - Intronic
1128072780 15:64807824-64807846 AGTTACAAGCTAGGGCTGGGAGG - Intergenic
1128821896 15:70664140-70664162 ATTTAGAAGCTAATGTTGGAAGG - Intronic
1132712358 16:1274845-1274867 ATTTAAAAGGTATTGGTGGATGG - Intergenic
1133511014 16:6457442-6457464 AAATCAAAGCTATTGCGGGGGGG - Intronic
1139974936 16:70801934-70801956 ATTTAAAAGCAATTTATGGCCGG + Intergenic
1141270534 16:82536478-82536500 AGTTAAGACCTATTGCTGGTGGG - Intergenic
1141679984 16:85538207-85538229 ATTAAAAACCCATTGCTGGCGGG - Intergenic
1148321167 17:46754413-46754435 ATTTGAAAGTTATTCCTGGAGGG + Intronic
1153156782 18:2159143-2159165 ATTTAAGAGCTTTTTTTGGGGGG + Intergenic
1153564729 18:6408368-6408390 ATTTATAAGCTCTTGCTGGTGGG - Intronic
1154945580 18:21158444-21158466 ACTAAAAAGCTATTCCTGGAGGG - Intergenic
1155675921 18:28428581-28428603 ATTTGTAAGATTTTGCTGGGGGG + Intergenic
1157483786 18:48073017-48073039 ATTTAACAGCACATGCTGGGCGG + Intronic
1158661066 18:59387934-59387956 ATTGAAAAGCTATTGCTCTGTGG - Intergenic
1160209520 18:76865038-76865060 AATTAAAAGACATTGCTGGCTGG + Intronic
1162347939 19:10131739-10131761 GTTTAAGATCTCTTGCTGGGGGG + Intergenic
1163179846 19:15591631-15591653 TTTTAAAAGAAATTGCTGGTCGG - Intergenic
1166581016 19:43899766-43899788 ATTTAAAAGGTAAGGCAGGGAGG - Intronic
1202652609 1_KI270707v1_random:20577-20599 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1202659523 1_KI270708v1_random:55106-55128 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
926799900 2:16651104-16651126 TTTCAACAGCTATTTCTGGGGGG + Intronic
927313906 2:21660060-21660082 ATTTAAAATCTTTTGCTTGTGGG - Intergenic
928154362 2:28862692-28862714 ATTTAAAAGGTATTTGTGGCCGG + Intronic
928186748 2:29116868-29116890 TTTTAAAAGCCCTTGCTGGTGGG - Intronic
928476964 2:31637447-31637469 ATTTATAAACTGTTGCTGGTGGG - Intergenic
928739979 2:34340104-34340126 ATTCAAAAGCTATTGCTCCAAGG - Intergenic
928967901 2:36995628-36995650 ATTTTTAAACTATTACTGGGTGG - Intronic
929332236 2:40695976-40695998 ATTTAAAAGTCATTGGTGGCTGG + Intergenic
931021839 2:58054404-58054426 ATTTGAAACATATTGCTGTGGGG + Intronic
932220892 2:69998192-69998214 GTTAAGAAGCTATTGGTGGGAGG - Intergenic
932279940 2:70481814-70481836 ACTTACAAGCTATTGTTGGGAGG - Intronic
935424246 2:102903489-102903511 ATTTTAAAGCTTTTGCTCCGTGG + Intergenic
935494801 2:103767009-103767031 ATTAGATAGCTATTTCTGGGAGG + Intergenic
935734742 2:106097557-106097579 ATTTGAAACCTAAGGCTGGGGGG - Intronic
936551706 2:113448606-113448628 ATTAAAAATCTGTTGCTGGCCGG + Intronic
939468032 2:142583292-142583314 ACTTAAAATCTATTTCTGGATGG + Intergenic
940142744 2:150511804-150511826 ATTTAAAAATTATTGCTGAAAGG + Intronic
940617126 2:156062888-156062910 ATATAAAAGCTATTGCAGCCGGG + Intergenic
943029619 2:182670413-182670435 TTTTAAAAGCTATTGATAGCTGG - Intergenic
945299020 2:208198900-208198922 ATTTAAAGGCTATGGCTGCCTGG - Intergenic
945618124 2:212098982-212099004 ATTAAAAGGCTACTGCTGGCTGG + Intronic
946408945 2:219507055-219507077 ATTTAAATGCTAATGTGGGGGGG - Intergenic
947203348 2:227637034-227637056 ATCTAAAAGCAATTGCAGGCTGG + Intergenic
948225240 2:236304703-236304725 ATTTAAAATCCATTTCTGGCCGG - Intergenic
1169296619 20:4405479-4405501 ATTTAAAAGCTGTTTCTGCAGGG - Intergenic
1170225142 20:13983815-13983837 TTTTAAAAGCTAGTGCTGGCGGG - Intronic
1173187792 20:40854485-40854507 ATTAAAGAACTATTGGTGGGGGG + Intergenic
1174313471 20:49678042-49678064 ATTTAAAAGATATTTCAGGCTGG - Intronic
1174447346 20:50599093-50599115 ATTTAATAGCTATTGTTGGCTGG + Intronic
1174495392 20:50937973-50937995 ATTTTAAAGGTAATGCTGGCTGG - Intronic
1174830551 20:53808291-53808313 ATTTAAAATGTACTACTGGGAGG + Intergenic
1176599543 21:8779077-8779099 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1176628516 21:9115958-9115980 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1177827003 21:26095273-26095295 ATTTAAAACTTATTGTTGGCTGG - Intronic
1178279532 21:31269480-31269502 ATTTGAAAGCTGTTCCTGAGAGG + Intronic
1179620407 21:42611567-42611589 ATTTAAAAGCTTTACCTGGTTGG + Intergenic
1180121237 21:45749836-45749858 ATATAAAAGACATTACTGGGGGG - Intronic
1180326991 22:11438667-11438689 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180378628 22:12117488-12117510 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1180418893 22:12795829-12795851 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1180512696 22:16108800-16108822 ATTAGAAAACTAGTGCTGGGGGG + Intergenic
1180632108 22:17236848-17236870 ATTTAAGAGCTATTTCTGGCCGG - Intergenic
1182498825 22:30730876-30730898 ATTAAAGAGCTAATGCTGGCCGG + Intronic
1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG + Intronic
949229636 3:1735383-1735405 GTTTAAATGCTTTTGCTGGAGGG + Intergenic
951169232 3:19519777-19519799 ATTCAAATGGTATTGATGGGTGG - Intronic
953757747 3:45662051-45662073 ATTTAAAAAATATTGCTGCCAGG - Intronic
955047779 3:55376194-55376216 ATTAAAAAGCCCTTTCTGGGAGG - Intergenic
955702096 3:61691895-61691917 ATTAACAATTTATTGCTGGGAGG + Intronic
956803273 3:72783174-72783196 ATTTTATAGCTGTGGCTGGGTGG - Intronic
957838705 3:85637304-85637326 ATTTAAAAGGTATTATTGGCCGG + Intronic
958042238 3:88240737-88240759 ATTTAAACCCTATTGCCGTGAGG + Intergenic
958713729 3:97752181-97752203 GTTTTAAAGCTGTTGCTGGAAGG - Intronic
959133564 3:102388790-102388812 AGTTAAAAAATATTTCTGGGGGG + Intronic
960913823 3:122677924-122677946 ATTTAACAGCCATTACTGGTAGG + Intergenic
961686221 3:128633508-128633530 TTTTAAAATCTCTTGCTGGTTGG - Intronic
961802000 3:129458032-129458054 ATTTAAAATCTATTCCTGGCCGG - Intronic
961975248 3:131017673-131017695 ATTTAAGAGATATTACTGGCCGG + Intronic
962735658 3:138323118-138323140 ATTAAAAAGCCAATGCTGGCCGG + Intronic
963188751 3:142446218-142446240 ATTCAAAAGCTAGTCCTGGGCGG - Intronic
963205738 3:142632423-142632445 ATTTAAAAAGTGTTGCTGAGGGG + Intronic
963742071 3:149090460-149090482 ATTTTAAAGCCATTGGTGTGGGG + Intergenic
964200399 3:154112353-154112375 ATTTCAAAGCGGTTGCTAGGTGG + Intergenic
966436663 3:179892683-179892705 ATTTAAAAGATGTGACTGGGAGG - Intronic
970329547 4:14965463-14965485 ATTTAAACACCATTTCTGGGAGG + Intergenic
970654108 4:18212616-18212638 GGTTAAAAGCCATTGTTGGGGGG + Intergenic
970952077 4:21768103-21768125 ATTTAGAAGCTCTTGCTTGGCGG - Intronic
971748965 4:30621737-30621759 ATGCAGAAGCTATTGCTTGGAGG + Intergenic
973362894 4:49181448-49181470 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
973398205 4:49615406-49615428 CTTTAGAAGCTGTTGGTGGGAGG - Intergenic
976225413 4:82791959-82791981 ATTTAAAAGCTGTGCCTGGCCGG + Intronic
976615719 4:87074074-87074096 AGTTAAAACCTATTGCTGCAGGG - Intronic
977299083 4:95247095-95247117 GTTTAAATGCTATCTCTGGGTGG + Intronic
977310360 4:95379067-95379089 ATTTAAAAACTATTGGTGCAGGG + Intronic
981113456 4:140961187-140961209 ATCTAAAAGACCTTGCTGGGAGG + Intronic
981233058 4:142381246-142381268 TTTTAAAAACCATTGCTGGCAGG - Intronic
982386455 4:154809988-154810010 ATTTAAAAGTTACTACTTGGAGG + Intronic
983999382 4:174222251-174222273 ATTTAAAAACTATTGTTATGGGG - Intergenic
1202760246 4_GL000008v2_random:102955-102977 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
986100268 5:4601903-4601925 TTTTTAAATGTATTGCTGGGCGG - Intergenic
986146751 5:5085045-5085067 AATCAAAAGCTATCACTGGGGGG - Intergenic
986600654 5:9469301-9469323 AATTAAAATCCATTGCTGGCCGG - Intronic
987947372 5:24629319-24629341 ATTTTAAAATTCTTGCTGGGTGG - Intronic
989408929 5:41094961-41094983 ATTGAAAAGCTTTAGCTAGGCGG + Intergenic
991159480 5:63480544-63480566 ATTTAAAAAATACTACTGGGAGG + Intergenic
993164644 5:84336601-84336623 ATTTAATAACTATGACTGGGAGG + Intronic
993777249 5:92014613-92014635 ATCCAAAAGCTATTGCTGATTGG - Intergenic
995834496 5:116386739-116386761 ATGTCTAGGCTATTGCTGGGTGG - Intronic
996349499 5:122522890-122522912 ATTTAAAAGCCATTGCTGGCCGG - Intergenic
997493348 5:134298228-134298250 TTTTAAAAGCTATTCATGGCTGG - Intronic
997546273 5:134710837-134710859 ATTTAAAAGCTCGTGTTGGCCGG + Intronic
997670993 5:135671869-135671891 ATTAAAAAGTTAATTCTGGGTGG - Intergenic
997919863 5:137968578-137968600 ATTAAAAAGCAATTTGTGGGGGG + Intronic
999528569 5:152436131-152436153 ATTTCCAAGCTTCTGCTGGGAGG + Intergenic
1000406289 5:160891732-160891754 ATTTAAAACCTGTTTCTGGCTGG - Intergenic
1000631917 5:163600370-163600392 ATTTAAAATCTGTTTCTGGCTGG - Intergenic
1001762752 5:174221778-174221800 ATTTGAAAGCTGTGGTTGGGAGG - Intronic
1001842864 5:174894139-174894161 AATTAGAAGCTATTCATGGGTGG - Intergenic
1001860272 5:175048103-175048125 ATTTAAAAGGTGTCGCTGCGTGG + Intergenic
1002892440 6:1347234-1347256 ATTTACAAGCTAGGGGTGGGGGG - Intergenic
1003520328 6:6853202-6853224 ATTTAAAAGCTTTTTCTGAATGG - Intergenic
1008945080 6:57088649-57088671 ATTTAAAAGCTCTTCCTAGTGGG - Intronic
1011305562 6:85922559-85922581 GTATAAAAGCAATTACTGGGGGG + Intergenic
1011617170 6:89207758-89207780 ATTTGAAAACTATTGCTGGCTGG - Intronic
1012613411 6:101245721-101245743 ATTTTAAAGCTGTTACTAGGTGG + Intergenic
1012972969 6:105751207-105751229 ATTTATAAATTATTGCAGGGAGG - Intergenic
1016171969 6:141029065-141029087 TATTTAAAGCAATTGCTGGGGGG - Intergenic
1017734039 6:157344566-157344588 ACTAAAAAGCTAGGGCTGGGGGG - Intergenic
1017989596 6:159474518-159474540 CTTTGAAATCCATTGCTGGGAGG - Intergenic
1020998810 7:15301140-15301162 ATTTAAAAGCAAATGCTGGCCGG + Intronic
1023103390 7:36740948-36740970 ATTTAAAGGCTATTGTTTGGTGG + Intergenic
1023924872 7:44660601-44660623 GTTGAAATGCTATTGTTGGGTGG + Intronic
1026298100 7:69073514-69073536 ATTTAAAAAGTATTGTTGGCTGG - Intergenic
1026593477 7:71715238-71715260 ATTTAAAAGCTCTGGATGGCCGG + Intergenic
1029160760 7:98549690-98549712 ATCTTAAACCTAGTGCTGGGGGG - Intergenic
1031380147 7:121075705-121075727 AGTTAAAATTTATTGATGGGTGG - Intronic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1033389600 7:140913776-140913798 ATTTAAAAGCTGTGGTTGGCCGG - Intronic
1033787332 7:144748858-144748880 AATTTAAAGCTGTTGCTAGGAGG + Intronic
1042705044 8:71657591-71657613 TTTTAAAAGGACTTGCTGGGTGG - Intergenic
1043238139 8:77895358-77895380 ATTTAAAAGTAATTGCAGGTTGG + Intergenic
1044609371 8:94077260-94077282 ATTTAAAAACTACTGCAGTGGGG + Intergenic
1044719582 8:95133207-95133229 ATTTAAAAGAAAGGGCTGGGTGG + Intergenic
1045558591 8:103238948-103238970 GTTTAAAAACTATTGCTGCCTGG + Intergenic
1046357407 8:113106685-113106707 ATTTATGAGGTGTTGCTGGGAGG + Intronic
1047568732 8:126074170-126074192 ATATAAAAGATCTTGTTGGGGGG - Intergenic
1047771538 8:128033941-128033963 ATTTGAAAGTGATTCCTGGGTGG + Intergenic
1049901292 9:168546-168568 ATTAAAAATCTGTTGCTGGCCGG - Intronic
1050245545 9:3685861-3685883 ATTTAAAAAATATTGTTGGCTGG + Intergenic
1050447958 9:5746768-5746790 ATTAAAAAGCCATTGATGGTAGG - Intronic
1051165641 9:14259602-14259624 GTTTAAAAGGTATTGGTGGCCGG + Intronic
1053744331 9:41178860-41178882 ATTAAAAATCTGTTGCTGGCCGG - Intronic
1054482938 9:65686338-65686360 ATTAAAAATCTGTTGCTGGCCGG + Intronic
1054684014 9:68252393-68252415 ATTAAAAATCTGTTGCTGGCCGG + Intronic
1055224878 9:73984170-73984192 AGTTGAAGGCTCTTGCTGGGAGG - Intergenic
1057077924 9:92149134-92149156 ATTTAAAAACTGATGCTGGCCGG + Intergenic
1057657898 9:96971860-96971882 CTTTAAAAATTATTGATGGGCGG - Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059167664 9:112094384-112094406 ATTTAAAAGCCCTTGGTGTGGGG - Intronic
1059171420 9:112128635-112128657 ATTTAAAAAGTGTTTCTGGGAGG - Intronic
1059843064 9:118240486-118240508 ATTCAAAAGCAATTGGTTGGGGG - Intergenic
1061242494 9:129382721-129382743 ATTGGGAAGCTATTGGTGGGAGG - Intergenic
1203482626 Un_GL000224v1:20717-20739 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1203541022 Un_KI270743v1:87849-87871 CTTTAGAAGCTGTTGGTGGGAGG + Intergenic
1186212294 X:7262209-7262231 ATGCAAAATCTATTGCTGGTTGG + Intronic
1186250840 X:7664504-7664526 ATTTGGATGCTATGGCTGGGTGG + Intergenic
1187250132 X:17590261-17590283 ATCTAAAAGCTTATGCTAGGTGG + Intronic
1188476090 X:30593793-30593815 AGTTAAAAACTATTGCTGTAGGG - Intergenic
1189482126 X:41400106-41400128 TTTTAAAAGCCTTTGCAGGGCGG + Intergenic
1194089815 X:89571227-89571249 ATTTGAAAGAAATTTCTGGGAGG - Intergenic
1194561354 X:95425768-95425790 AATTAAAAGCTTTTGTTGAGAGG + Intergenic
1196768305 X:119269761-119269783 ATTTAAAAAAAATTGCGGGGGGG - Intergenic
1197132260 X:123019403-123019425 ATTTAAAAATTAATGCTGAGAGG + Intergenic
1197902735 X:131391666-131391688 ATTTAAAATATATTCATGGGGGG - Intronic
1200442469 Y:3227277-3227299 ATTTGAAAGAAATTTCTGGGAGG - Intergenic
1201165019 Y:11201250-11201272 GTTTAGAAGCTGTTGGTGGGAGG - Intergenic
1201585336 Y:15554102-15554124 ATTCAAAATCTATTGCTGCTTGG + Intergenic