ID: 901815900

View in Genome Browser
Species Human (GRCh38)
Location 1:11793517-11793539
Sequence GAGGCACAAATATGGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901815898_901815900 -8 Left 901815898 1:11793502-11793524 CCAGGCTGGAGTGCAGAGGCACA 0: 267
1: 27687
2: 90133
3: 180933
4: 210949
Right 901815900 1:11793517-11793539 GAGGCACAAATATGGCTTACTGG 0: 1
1: 0
2: 0
3: 19
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901815900 Original CRISPR GAGGCACAAATATGGCTTAC TGG Intronic
901685219 1:10940069-10940091 GAGGCAGCAATGTGGCTTCCAGG - Intergenic
901815900 1:11793517-11793539 GAGGCACAAATATGGCTTACTGG + Intronic
901983373 1:13053818-13053840 GAGGCACAATGCTGGCTTAATGG - Intronic
902692966 1:18121751-18121773 GGGGGACAAATATGCCTTAGGGG + Intronic
903430597 1:23295668-23295690 GTGGCACCATTATGGCTCACTGG + Intergenic
903864294 1:26387162-26387184 GTGGCACAATTATGGCTCGCTGG + Intergenic
906661719 1:47587714-47587736 AAGTCACAAATATGGCATTCTGG + Intergenic
907977856 1:59449581-59449603 GATGCAAAAATATGGCATGCAGG - Intronic
908471622 1:64449546-64449568 GTGGCACAATTATGGCTCATTGG - Intergenic
908798089 1:67851491-67851513 GTGGCACAATCATGGCTCACTGG + Intergenic
909198377 1:72656289-72656311 GTGGCATAATTATGGCTTCCTGG - Intergenic
910636293 1:89412486-89412508 GTGGGACAAATATGGCCTGCCGG + Intergenic
910998528 1:93135750-93135772 GTGGCACAATCATGGCTCACAGG - Intronic
914819466 1:151089570-151089592 GAGGTACAAATTTGACTGACTGG - Intronic
915936267 1:160091915-160091937 GAGGCACAAATAGGGTGTCCAGG + Exonic
916828009 1:168462441-168462463 GGGGGACATATATGGCGTACTGG - Intergenic
923271730 1:232360939-232360961 GAGGGAAAAATATGGATTTCAGG - Intergenic
1062903213 10:1161410-1161432 GAGGCACAGAGAGGGCTCACTGG - Intergenic
1066990428 10:42507988-42508010 GAGGGAGAAATAGGGATTACAGG - Intergenic
1068085366 10:52367226-52367248 GGGGAAGAAATATGGATTACAGG - Intergenic
1068163609 10:53299780-53299802 GAGACACAAATATGGCCAATAGG - Intergenic
1068647836 10:59488580-59488602 GAGGCACAAAGATAGCTTGCAGG - Intergenic
1069058494 10:63869297-63869319 GAGGCACAGATATGTCTTCTAGG + Intergenic
1070244558 10:74718995-74719017 GTGGCACAATCATGGCTCACTGG + Intergenic
1071336987 10:84608371-84608393 AAGGTACAAATCTGGGTTACAGG + Intergenic
1072627419 10:97121838-97121860 GATGGACACATATGGCTTAACGG + Intronic
1073229308 10:101954131-101954153 ATGGCACAATTATGGCTCACTGG - Intronic
1076553595 10:131305223-131305245 GAGGCTCAAAAATGGCCAACAGG + Intronic
1078807879 11:14724906-14724928 CAGGCACAAATATGGAATCCAGG + Intronic
1080550165 11:33367430-33367452 GTGGCACAATTATAGCTCACTGG - Intergenic
1081921274 11:46779676-46779698 GTGGTACAAACATGGCTCACTGG + Intronic
1085595230 11:77803204-77803226 GTGGCACAACCATGGCTCACTGG + Intronic
1085984410 11:81768370-81768392 ATGGCACAAATATGGCTCACGGG + Intergenic
1086727753 11:90209677-90209699 GAGGCAGGAAAATGGCTTACTGG + Intronic
1088773317 11:113057484-113057506 GAGGGACAACTATGGCTTCTTGG + Intronic
1093508262 12:19894837-19894859 GAGTCACATATATGGGTTAAAGG + Intergenic
1093785284 12:23185412-23185434 GAGGCACACCTGTGGGTTACAGG - Intergenic
1094332107 12:29305190-29305212 GTGGCACAATTATGGCTCATTGG + Intronic
1094780857 12:33790127-33790149 GAGGAAAAAAAATGGCTTCCTGG - Intergenic
1095994697 12:48071023-48071045 GTGGCACAATCATGGCTCACTGG - Intronic
1098095339 12:66948622-66948644 GAGGAATAAATATGGCACACAGG + Intergenic
1098496184 12:71137961-71137983 GAAACACAATTATGGCTTCCTGG + Exonic
1099786687 12:87273608-87273630 GTGGCACAATCTTGGCTTACTGG + Intergenic
1101116933 12:101541210-101541232 GTGGCACAACCATGGCTCACTGG + Intergenic
1101158967 12:101954567-101954589 GAGAGTGAAATATGGCTTACTGG + Intronic
1103237054 12:119382259-119382281 GAGGCAGAGATATGTCTTCCAGG + Intronic
1103809007 12:123598991-123599013 GTGGCACAAACATGGCTCACTGG + Intergenic
1106804527 13:33292540-33292562 GTGGCACACTCATGGCTTACTGG - Intronic
1108802163 13:54111898-54111920 GTGGCACAATCATGGCTTGCTGG - Intergenic
1109914489 13:68962982-68963004 GTGGCACAATCATGGCTCACTGG - Intergenic
1111977495 13:94982113-94982135 GAGTTAGAAATATGGCTTAAAGG - Intergenic
1114943035 14:27640057-27640079 GAGGCAAGAATTTGGCTCACTGG - Intergenic
1115536411 14:34377455-34377477 GAGGTACAAACATCACTTACTGG + Intronic
1116211000 14:41943823-41943845 CAGACATAAACATGGCTTACAGG + Intergenic
1117788982 14:59318309-59318331 GAGGCACAAATGTGGCCCAGAGG - Intronic
1118303740 14:64637369-64637391 GTGGCACAATTATAGCTCACTGG + Intergenic
1119061478 14:71479452-71479474 GTGGCACAATTATAGCTAACTGG + Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1125916682 15:43493742-43493764 TGGGAAGAAATATGGCTTACTGG - Intronic
1129303344 15:74639835-74639857 GGGGCAATAATATGGCTTACTGG + Intronic
1130052442 15:80495086-80495108 GAGACAAAAAAAAGGCTTACAGG - Intronic
1132381509 15:101369673-101369695 GATGCAAATATATGACTTACAGG - Intronic
1133082396 16:3333155-3333177 AAGACATAAATATGGCCTACAGG - Intergenic
1134834323 16:17348224-17348246 GAGGCACAAAGAGGGCGTGCGGG + Intronic
1135172030 16:20193193-20193215 GTGGCACAATTATAGCTCACTGG - Intergenic
1135630261 16:24031003-24031025 GTGGCACAATTATAGCTCACTGG - Intronic
1135806395 16:25546641-25546663 GTGGCACAATCATGGCTCACTGG + Intergenic
1136525405 16:30826413-30826435 GTGGCACAATCATGGCTCACTGG + Intergenic
1137431958 16:48425855-48425877 GAGGTACAAATGTGGCTTCCAGG - Intronic
1138499519 16:57430835-57430857 GTGGCACAATAGTGGCTTACTGG + Intronic
1140203722 16:72915702-72915724 GTGGCACAAACACGGCTCACTGG - Intronic
1140752396 16:78037316-78037338 GAGGAAGAAATATGTCTTGCAGG - Intronic
1140889576 16:79273483-79273505 GATGCACAAATAGGTCTCACTGG + Intergenic
1141335396 16:83150042-83150064 GAGGCAAAAATCAGTCTTACAGG - Intronic
1143525820 17:7471848-7471870 AAGGCACAAATTGGGCTTCCTGG + Intronic
1146020865 17:29277624-29277646 TAGGCACAAGTATGGCAGACTGG - Intronic
1146315234 17:31801760-31801782 GAGACACAAATATGAGTAACAGG - Intergenic
1146987334 17:37232820-37232842 AAGGGACAAATCTGGCTTCCTGG + Intronic
1152330404 17:79669403-79669425 GAGGCACACAGAAGGCTTCCTGG + Intergenic
1152498313 17:80690851-80690873 GTGGCGCAAACATGGCTCACTGG + Intronic
1152838878 17:82553562-82553584 GAAGCACAAACATGGTTTTCGGG + Intronic
1203168879 17_GL000205v2_random:128076-128098 GAGATACAAAAATGGCTAACTGG + Intergenic
1153068531 18:1077604-1077626 GTGGCACAAACAGGGCTCACTGG + Intergenic
1157048503 18:44132276-44132298 GAGCCCCAAATATGAATTACTGG + Intergenic
1157428654 18:47605093-47605115 TAAGCACATATTTGGCTTACTGG + Intergenic
1157645895 18:49270791-49270813 GAGGCAAAAACATGACTTAAGGG + Intronic
1162356407 19:10188065-10188087 GCGGCACAATTATAGCTCACTGG - Intronic
1162856433 19:13472019-13472041 GGGGCACAATCACGGCTTACTGG + Intronic
1162970522 19:14178444-14178466 ATGGCACAATCATGGCTTACTGG - Intronic
1163809693 19:19423063-19423085 GTGGCACAAAAATGGCTCACTGG + Intronic
928197731 2:29227457-29227479 GAGGCACAATTATGGGTCCCTGG - Intronic
929379138 2:41329219-41329241 GAAGCAGACATATGGCTCACAGG + Intergenic
929493364 2:42417377-42417399 GCTGCACAATTATGGCTTACTGG + Intronic
936468811 2:112778999-112779021 AAGCTACAAATATGGCTTAAAGG - Intronic
937850450 2:126627821-126627843 TTGGCACAAATGTGGCTAACTGG - Intergenic
937945591 2:127333071-127333093 GAGGCACAGTCATGGCTTACTGG - Intronic
941096112 2:161240024-161240046 GAGGTCCATCTATGGCTTACGGG - Intergenic
944587357 2:201184380-201184402 GTGGCACAATCATGGCTCACTGG + Intronic
944718302 2:202397555-202397577 GTGGCACAAACATGGCTCCCTGG + Intronic
944803371 2:203257958-203257980 GTGGCACAATTATAGCTCACTGG + Intronic
944946526 2:204693328-204693350 GAGGCACAAAAACAGCTGACAGG - Intronic
1170906750 20:20522573-20522595 GAGGCACAGAGAAGGCTTCCAGG + Intronic
1171097970 20:22350472-22350494 GAGGCAGAAATATCGCTGAATGG - Intergenic
1173940284 20:46905125-46905147 GAGACATAAAAATGGCTCACAGG + Intronic
1174826696 20:53775075-53775097 GAAGAACAAATATGGCTTCCAGG - Intergenic
1174827069 20:53778066-53778088 GAAGAACAAATATGGCTTCCAGG - Intergenic
1177055736 21:16298594-16298616 GGAACACAAATATGGCTCACAGG + Intergenic
1177763231 21:25426409-25426431 GAGGCATAAATATGGCATCTTGG + Intergenic
1178591149 21:33911521-33911543 GAGGCTCAGATATGTCTTACAGG - Intronic
1180013042 21:45064033-45064055 GTGGCACAACCATGGCTCACTGG - Intergenic
1181286516 22:21756433-21756455 GTGGCACAATTATGGTTCACTGG + Exonic
1182579496 22:31297264-31297286 GAGGCATAATTGTAGCTTACTGG - Intergenic
1183787981 22:40042479-40042501 GAGGGACAGAAATGGCTTCCTGG - Exonic
1185405260 22:50644505-50644527 GAGGAACAAGCATGGCTTAAAGG + Intergenic
949995642 3:9614337-9614359 GTGGCACAATCATGGCTTGCTGG - Intergenic
952674951 3:36017528-36017550 AAGGCATAAAAATGGCTAACAGG - Intergenic
955008690 3:54993465-54993487 GAAGCACAAATATGACTTTTAGG + Intronic
955118948 3:56036477-56036499 GAGGGACCAAGATGGCTGACTGG + Intronic
955309818 3:57874231-57874253 GTGGCACAACTATAGCTCACTGG - Intronic
956080320 3:65549705-65549727 GGGAGACAAATATGGCTTTCAGG + Intronic
956711772 3:72044460-72044482 GAAGCACACATATGGCTCATTGG - Intergenic
958887470 3:99743063-99743085 GAGGCACAAAAATTACTTATAGG + Intronic
962636595 3:137338326-137338348 TAGGAACAAAAATGGCTTCCTGG + Intergenic
963994253 3:151688819-151688841 GAGGGACACATTAGGCTTACTGG + Intergenic
964266701 3:154905223-154905245 GAGGTACAAATATGAATAACTGG + Intergenic
964504597 3:157384919-157384941 GACCCACAATTAAGGCTTACAGG - Intronic
970984310 4:22138196-22138218 GAGTTACTCATATGGCTTACAGG + Intergenic
972282669 4:37618267-37618289 GTGGCACAATCATGGCTTGCTGG + Intronic
975128497 4:70808743-70808765 GGGGCACAAAAATGGACTACAGG + Intergenic
979843671 4:125479788-125479810 GTGGCACATGTATGGATTACTGG + Exonic
980710843 4:136565014-136565036 GAGCTACAAAGATGGCTTATGGG + Intergenic
981284535 4:143000407-143000429 GTGGCACAATCATAGCTTACTGG - Intergenic
982291182 4:153784408-153784430 GAGCCACAAATGGGGCTGACGGG - Intronic
984207054 4:176797912-176797934 GAGGCAGGAATATGGCTTGGAGG - Intergenic
984471188 4:180176684-180176706 GAGGCACAAAGATGGGGAACTGG - Intergenic
986576518 5:9219076-9219098 GGGGCATAAATTTGTCTTACTGG - Intronic
987648127 5:20702898-20702920 GAGGCACAATTATTGCTAATTGG + Intergenic
988748203 5:34165973-34165995 GAGGCACAATTATTGCTAATTGG - Intergenic
990106370 5:52268105-52268127 GTGGCATAATCATGGCTTACTGG + Intergenic
990261827 5:54031238-54031260 GATGCACAAGAGTGGCTTACAGG - Intronic
991679262 5:69122298-69122320 GAGGCAGAAGAATCGCTTACAGG + Intronic
993109230 5:83635059-83635081 AAGGCAATAATATGTCTTACAGG + Intergenic
993421107 5:87701540-87701562 GAGGCACCAAGATGGCTGACTGG - Intergenic
997166433 5:131664574-131664596 GTGGCACGAACATGGCTTACTGG - Intronic
997606398 5:135178316-135178338 GAGACAAAAATCTGCCTTACAGG + Intronic
998521612 5:142806149-142806171 AAGGCACAAAGACGGCTCACTGG + Intronic
1001084238 5:168688811-168688833 GAGACACACAGATGGCTTCCTGG - Intronic
1008699179 6:54078523-54078545 GTGGCACAATCATGGCTCACAGG - Intronic
1012784964 6:103612715-103612737 GTGGTACAATCATGGCTTACTGG - Intergenic
1020419651 7:7987230-7987252 GAGGCACAAGTATTCCTGACAGG - Intronic
1021085056 7:16412898-16412920 GAATAACAAATATTGCTTACAGG + Intronic
1021239062 7:18178140-18178162 GTGGCACAATCTTGGCTTACTGG + Intronic
1023075788 7:36481659-36481681 GAGACACATCTATGACTTACTGG - Intergenic
1023205424 7:37744308-37744330 TAGCTACAAATATTGCTTACAGG - Intronic
1025066057 7:55857009-55857031 GTGGCACAATCTTGGCTTACTGG - Intronic
1027112078 7:75448176-75448198 GTGGCACAATTATGGCTCACTGG - Intronic
1027214862 7:76177203-76177225 GAGGCACAAAAATCGCTTGATGG - Intergenic
1027284312 7:76632712-76632734 GTGGCACAATTATGGCTCACTGG - Intergenic
1027751343 7:82150330-82150352 GAAGCAAAATAATGGCTTACTGG - Intronic
1029162006 7:98559217-98559239 GTGGCACAATCATGGCTCACTGG + Intergenic
1029185357 7:98734509-98734531 GTGGCACAATCATGGCTCACTGG + Intergenic
1029647065 7:101864217-101864239 GTGGCACAATCATGGCTCACTGG + Intronic
1031717525 7:125126664-125126686 GATACACAAATAAGGCTTGCAGG - Intergenic
1031968515 7:128046153-128046175 GTGGCACAATCATGGCTCACTGG + Intronic
1032130420 7:129223486-129223508 GAGGCACAAATTTGGCGATCAGG - Intergenic
1033516087 7:142108015-142108037 TTGGAACCAATATGGCTTACCGG + Intergenic
1034072547 7:148200451-148200473 GTGGCACAATCATGGCTCACTGG + Intronic
1035941699 8:3908750-3908772 AAGGCACCAAACTGGCTTACAGG + Intronic
1037513807 8:19610229-19610251 GTGGCACAATTTTGGCTCACTGG - Intronic
1042398517 8:68318567-68318589 GTGGCACAATCATGGCTCACTGG + Intronic
1042798085 8:72686404-72686426 GTGGCACAATCATAGCTTACTGG + Intronic
1043143237 8:76617629-76617651 GAGCCACAAGTATGGCTGAATGG + Intergenic
1045107491 8:98907097-98907119 GTGGCACAATCATGGCTCACTGG - Intronic
1045363059 8:101450570-101450592 GAGGAACAGATGTGGCTTCCAGG + Intergenic
1045824714 8:106383439-106383461 AGGGCACACATCTGGCTTACAGG - Intronic
1046855311 8:119025057-119025079 TAGACACAAATATGTGTTACTGG - Intronic
1047685789 8:127303526-127303548 GAGGCACAGATAGGGCGCACAGG + Intergenic
1048125271 8:131628069-131628091 AAGGCACACATATGGCCTCCAGG + Intergenic
1048951994 8:139504268-139504290 CAGCAACAAATATGGCTTCCTGG - Intergenic
1049149542 8:141025722-141025744 GTGGCACAATTTTGGCTCACTGG - Intergenic
1050835188 9:10068587-10068609 GAGGGACAAATATGGTTTGGTGG - Intronic
1051533789 9:18134095-18134117 CATGCACAGATATGGCTTAATGG - Intergenic
1051745326 9:20290046-20290068 GAGCCACAACAGTGGCTTACAGG + Intergenic
1054790971 9:69256322-69256344 GTGGCAGAAATTTGGCTTACTGG + Intergenic
1056551597 9:87657610-87657632 TAGGCACAAACAAGGCTTATGGG + Intronic
1057079995 9:92166956-92166978 GAGGCACAAGAATTGCTTGCAGG + Intergenic
1059735915 9:117099431-117099453 GGTGAACAAATCTGGCTTACAGG + Intronic
1061386633 9:130294529-130294551 GAGGCACCAAGAGGGCTTCCTGG + Intronic
1203437254 Un_GL000195v1:150617-150639 GAGATACAAAAATGGCTAACTGG - Intergenic
1185971190 X:4666418-4666440 GTGGCACGATCATGGCTTACTGG - Intergenic
1192834031 X:74780433-74780455 GTGGCATGAATATGGCTCACTGG + Intronic
1196557018 X:117100278-117100300 GTGGCACAATCTTGGCTTACTGG - Intergenic
1197563166 X:128048533-128048555 GAAGCACCAAGATGGCTGACTGG - Intergenic
1201853154 Y:18511075-18511097 GTGGCACAAGTATGGCTCACTGG - Intergenic
1201880167 Y:18809309-18809331 GTGGCACAAGTATGGCTCACTGG + Intronic