ID: 901817145

View in Genome Browser
Species Human (GRCh38)
Location 1:11800774-11800796
Sequence CTCTGGTGCCCGCTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901817145_901817150 3 Left 901817145 1:11800774-11800796 CCTGACAACAGCGGGCACCAGAG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 901817150 1:11800800-11800822 TGACCGGCTATTCTCACTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 60
901817145_901817153 26 Left 901817145 1:11800774-11800796 CCTGACAACAGCGGGCACCAGAG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 901817153 1:11800823-11800845 ATACTCTGTTACTCTGTGATTGG 0: 1
1: 0
2: 1
3: 11
4: 231
901817145_901817154 27 Left 901817145 1:11800774-11800796 CCTGACAACAGCGGGCACCAGAG 0: 1
1: 0
2: 1
3: 9
4: 139
Right 901817154 1:11800824-11800846 TACTCTGTTACTCTGTGATTGGG 0: 1
1: 0
2: 2
3: 23
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901817145 Original CRISPR CTCTGGTGCCCGCTGTTGTC AGG (reversed) Intronic
900229691 1:1550485-1550507 CTGTGGTGTCCGCTGGTGTCTGG - Intronic
900584280 1:3424951-3424973 GTCTCCTGCCCTCTGTTGTCTGG - Intronic
901817145 1:11800774-11800796 CTCTGGTGCCCGCTGTTGTCAGG - Intronic
902423352 1:16299342-16299364 CTCAGGGCCCCGCTGTTGGCTGG - Intronic
902833707 1:19033915-19033937 CTCTGGTGCTGGCTTTTATCTGG - Intergenic
903929307 1:26853262-26853284 CTCTGGTGCCCCCTGGTGTCAGG - Intronic
904722409 1:32520593-32520615 CTCTGGCGCCCTCTATTGACAGG - Intronic
905006506 1:34714227-34714249 CTATTGTTCCCGCTGTTGCCAGG + Intronic
905309202 1:37037778-37037800 CCCTGGTGCCTGCTGGTGGCGGG - Intergenic
906096793 1:43229381-43229403 CGCTGGTGCCAGTTGCTGTCAGG + Intronic
906642906 1:47452249-47452271 CTCTGGTGCCTGGTGTGGTGGGG + Intergenic
911059474 1:93735183-93735205 CTCTGGTGCCCCCTCTGGCCTGG + Intronic
912202814 1:107477424-107477446 CTCTAGTGCCCCCTGTTGGTGGG + Intronic
912585162 1:110756676-110756698 AGCTGGTGCCTGCTGTTGGCTGG + Intergenic
918872464 1:189993050-189993072 CTCTGGTGACCACGGTGGTCCGG - Intergenic
921824868 1:219661111-219661133 CTCTGGCGCCCTTTGTTTTCTGG + Intergenic
922632167 1:227126401-227126423 CTCTGGTGGCTGCTGGTGACAGG + Intronic
923755146 1:236785315-236785337 CTGTGCTGCCCACTCTTGTCTGG + Intergenic
1062879656 10:967681-967703 CTCTGTTGCCCCCTGAAGTCCGG - Intergenic
1063952603 10:11237723-11237745 CCCCAGTGCCAGCTGTTGTCAGG - Intronic
1064692263 10:17930391-17930413 CTATGATGCCCTCTGTTGACTGG + Intergenic
1067052072 10:43027542-43027564 CTCGAGTGCCCGCTGTAGGCTGG - Intergenic
1072626747 10:97116950-97116972 CTCTGCTGCCCACTGTTGTGAGG + Intronic
1072849959 10:98879457-98879479 CTCTTGTTCCAGCTGGTGTCTGG + Intronic
1074005622 10:109420185-109420207 CTCTGGTGCCAGTTGTTATAAGG + Intergenic
1075258335 10:120942998-120943020 CTCTGCTGCCCTCTGCTGCCCGG - Intergenic
1076012643 10:127002858-127002880 CTCTGGTACCCACTGATATCGGG + Intronic
1077116427 11:886989-887011 GTCTCCTGCCCGCTGTTCTCTGG + Intronic
1078159555 11:8828834-8828856 CTCTGCTCCCCGCTCTTGTCTGG - Intronic
1081525308 11:43924241-43924263 ATCTGGTGTCCGCAGTGGTCTGG + Intergenic
1081793536 11:45804984-45805006 CTCCGCTGCCCGCTGCTGGCGGG - Exonic
1081856140 11:46305063-46305085 CTTTGGGGCCTGCTGTGGTCGGG - Intronic
1084088451 11:66865471-66865493 CTCTGGTCCCAGCTGTGGGCAGG - Intronic
1085307237 11:75493746-75493768 AACTGGTGCTCGCTGCTGTCTGG - Intronic
1089964274 11:122642904-122642926 TTCTGGTCCCCTCTGTTTTCAGG - Intergenic
1091386798 12:101109-101131 CTCTGGTGCCCGCCCCTGCCAGG - Intronic
1091776916 12:3190668-3190690 CTCTGCTGCCCCCTCTTATCTGG + Intronic
1095840293 12:46685014-46685036 CTCTGGTCCCTGCTGTTCCCAGG - Intergenic
1096123144 12:49101583-49101605 CTCTGGGTCCAGCTGTGGTCTGG - Intronic
1096597947 12:52709132-52709154 CCCTGCTTCCCGCTGCTGTCTGG - Intergenic
1101482181 12:105108251-105108273 CTCTGGAGGACGCTGATGTCTGG + Intronic
1101777822 12:107809603-107809625 CTCTCTTGCCTGCTTTTGTCTGG - Intergenic
1104880179 12:132065279-132065301 CTCAGGTGACCGCTGTAGGCAGG + Intronic
1108323194 13:49306108-49306130 CTCTGGCTCCCCTTGTTGTCAGG + Intergenic
1110760576 13:79225990-79226012 CTCTGAGGCCTGCTGATGTCAGG - Intergenic
1113670288 13:112171334-112171356 AGCTGGTGCCCGCTGCTGTGGGG - Intergenic
1119406076 14:74400559-74400581 CTCTGGTCCCTGCTGGTCTCTGG - Intergenic
1120874480 14:89363071-89363093 CTCTTTTGTCCTCTGTTGTCTGG - Intronic
1122129548 14:99597143-99597165 CTCTGGTGACCACTGTGGTGTGG - Intronic
1122432667 14:101665662-101665684 TTCTGGTGCCCCCTGGTGCCTGG + Intergenic
1124056415 15:26244390-26244412 CTCTGGTTCCCTCTGTCCTCAGG + Intergenic
1125360344 15:38858053-38858075 CTCTGGAGCCACCTGTTGTCAGG + Intergenic
1127626032 15:60781248-60781270 CTCTGGTGCCCGCAGCTTTCAGG + Intronic
1135293419 16:21259667-21259689 CTCTGCTGCCTGCTTTTGTGTGG - Intronic
1137038822 16:35591242-35591264 CTCTTGTGCCTGCAGTTATCCGG + Intergenic
1138087233 16:54144072-54144094 CTCTGGGGCATGCTGTTCTCAGG - Intergenic
1141995985 16:87636567-87636589 CTTTGGTGCCCTCTGCTGTGGGG + Intronic
1144047621 17:11468098-11468120 CTCTGTTTCCCTCTGTTCTCTGG + Intronic
1149517034 17:57288540-57288562 CTCCGGTGCACGCTGCTCTCAGG - Intronic
1150816292 17:68394837-68394859 CTCTGCAGCCAGCTGTTGCCTGG - Intronic
1151437325 17:74105944-74105966 CTCTGGGGGCTGCTGTTGTGGGG - Intergenic
1151763778 17:76121940-76121962 CTCTGGCACCCGCTGCTGCCCGG + Intergenic
1151847039 17:76663855-76663877 CTCTGGTGCCCTCTCTGGGCTGG + Intergenic
1152919438 17:83058663-83058685 CTGTGGTGCCTGCCGTAGTCTGG + Intergenic
1156229889 18:35142958-35142980 CCCTCGTGCCCGCTGTCGGCTGG + Exonic
1159207566 18:65273208-65273230 ATCTGGTCCCAGCTGTTGTATGG - Intergenic
1160243865 18:77141868-77141890 CTCTGTTGCCCTCTGTTGGCTGG - Intergenic
1160344652 18:78123337-78123359 CTCTCGTCCCCTCTGTTGTAAGG - Intergenic
1160881286 19:1321915-1321937 CTGTGGTGGCAGCTATTGTCAGG + Intergenic
1161392902 19:4030751-4030773 CTCTGGTGGCCACTGTCTTCAGG + Intronic
1165304492 19:34995198-34995220 CTCTGGTGCCCACTGAGGCCTGG + Intronic
1166361764 19:42255449-42255471 CTCTGGAGCCCGCAGTGGGCAGG - Intergenic
1168592392 19:57648099-57648121 CTTTGTTCACCGCTGTTGTCGGG - Intergenic
927899630 2:26809975-26809997 CTCTGGTGCCCTCTCTAATCTGG - Intergenic
932481460 2:72042003-72042025 CTCAGGTGCCTGCTGGTGACAGG + Intergenic
934925677 2:98380381-98380403 CTCTGGTGCCTGCTGGGGCCAGG + Intronic
935202100 2:100866072-100866094 CTCTGGTCCCTGCAGCTGTCTGG + Intronic
937255884 2:120555227-120555249 CACTGGTGCTGGCTGTTGGCGGG + Intergenic
937404459 2:121613991-121614013 CTCTGGTGCTGGCTGTTGGCTGG + Intronic
940174116 2:150860060-150860082 CTCTGAGGCCCTCTCTTGTCTGG - Intergenic
942103066 2:172605189-172605211 CTCTTGTGCCTCCTGTTGACTGG - Intronic
943699386 2:190973252-190973274 CTCTAGTGCATGCTTTTGTCCGG - Intronic
948731636 2:239967665-239967687 CCCTGTTCCCCGCTGTTGCCAGG - Intronic
1170383942 20:15795504-15795526 CACTGTTGCCCGCCATTGTCTGG + Intronic
1171535858 20:25888625-25888647 CTCTGTTGCTTGCTTTTGTCAGG - Intergenic
1173236409 20:41249927-41249949 CTCTGCTGCCCTCTGTTGCTAGG - Intronic
1173943734 20:46933530-46933552 CACTGATGCCATCTGTTGTCTGG - Intronic
1174369271 20:50075593-50075615 CTCTGCTGCCCGCTGGCCTCAGG - Intergenic
1175341575 20:58234101-58234123 CTCTGGTGCCCGTGGTCATCAGG + Intergenic
1175887526 20:62300920-62300942 CTCTGTGGCCCGCTGGTGACAGG - Intergenic
1178667652 21:34563072-34563094 TTGTGGTGTCCGCTGTTTTCAGG + Intronic
1181083340 22:20428038-20428060 TTCTGGGGCCCCCTGTTGTGGGG - Intronic
1183608883 22:38884040-38884062 CTCTGGTCCCCGCTGTGAGCAGG - Intergenic
1183667516 22:39254149-39254171 CTCTGGCGCCCGCTGCAGTGTGG + Intergenic
1184250859 22:43259479-43259501 CTCTGGTACCAGCTGTGCTCAGG - Intronic
1184804020 22:46780835-46780857 CTGTGTTGCACGCTGCTGTCAGG + Intronic
1184829233 22:46973306-46973328 CTCTTTACCCCGCTGTTGTCCGG + Intronic
950186787 3:10950430-10950452 CTCTGGTGCCCACTGTTACCGGG - Intergenic
950546083 3:13638820-13638842 CTCTGATGCTCGCTGTGGGCTGG - Intergenic
952763153 3:36933506-36933528 CTCTGGTGCTCACTGCTGTGTGG - Intronic
959437191 3:106330426-106330448 CCCTGGTCCCCACTGTTCTCAGG + Intergenic
959892320 3:111570552-111570574 ATCTAGTGCCCCCTGATGTCTGG - Intronic
961450190 3:126999172-126999194 CTCTGCTGCCCTCTCTTCTCAGG - Intronic
962696417 3:137951890-137951912 CTCTGGGGCCTGTTGTTGTTGGG - Intergenic
962891004 3:139673021-139673043 CACTGCTGACTGCTGTTGTCCGG - Intronic
965403984 3:168248746-168248768 GCCCGGTGCCAGCTGTTGTCTGG - Intergenic
966046395 3:175556024-175556046 CTCTGGAGTCTGCTGTTCTCTGG - Intronic
967106738 3:186260597-186260619 CTCTGGAGCCCACTGGTGGCAGG + Intronic
968045131 3:195619706-195619728 CTGTGGTGCCGGCTGTGGACAGG - Intergenic
968060986 3:195726043-195726065 CTGTGGTGCCGGCTGTGGACAGG - Exonic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
972745180 4:41925154-41925176 CTTTGGGGCCTGCTGTTGCCTGG + Intergenic
973334771 4:48944839-48944861 CTCTAGTGCCCCCTATTGGCAGG + Intergenic
975307130 4:72863105-72863127 CTCTGCTGCCTGCTGTAGTGTGG - Intergenic
980551241 4:134338178-134338200 CTCAGCTGCCAGCTGTTTTCAGG + Intergenic
989102903 5:37837553-37837575 TTCTGGTGCCCCCTGCTGCCGGG - Intronic
989147407 5:38262265-38262287 TGCTGGTTCCCGCAGTTGTCTGG - Intronic
997806085 5:136919603-136919625 CTCTGGGGCCCGCTGTGTGCAGG - Intergenic
999752700 5:154641445-154641467 CTGTGCTGCCCGCTGTGGTGGGG + Intergenic
1002827209 6:784672-784694 CTCTAGTGCCCACTGTCTTCTGG - Intergenic
1002964794 6:1953143-1953165 CTGTGCTGCCGGCTGTTGGCAGG - Intronic
1004537571 6:16517871-16517893 CCCTGGTGCCCTGTCTTGTCTGG - Intronic
1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG + Intergenic
1008411380 6:51184214-51184236 CTCTTGTGCCAGATGGTGTCTGG - Intergenic
1017908146 6:158770876-158770898 CTCTGTTTCCAGCTGTTGCCTGG + Exonic
1018349769 6:162943970-162943992 CTCCGGTGCCAGCTGTGGGCTGG - Intronic
1019138922 6:169930991-169931013 CTCTAGTGCCTCCTGGTGTCTGG + Intergenic
1019442409 7:1054071-1054093 CTCAGGTTCCCGCCTTTGTCAGG - Intronic
1019478138 7:1253961-1253983 CTCTGGGGCCCCCTGTTTCCGGG - Intergenic
1023957103 7:44895165-44895187 CTCTGGTCCCAGCTGCTGTGGGG + Intergenic
1023982878 7:45079971-45079993 CTCTGGTGTCCCCTGCTCTCTGG - Intergenic
1024270490 7:47637920-47637942 CTCTGTTGCCCTCTGTTGCTCGG + Intergenic
1031252458 7:119404521-119404543 CTCTTGTGTCTGCTGTTATCTGG - Intergenic
1031904711 7:127447492-127447514 CTCTGTTGCCCTCTGTTGCCCGG - Intergenic
1035235415 7:157494741-157494763 CTCAGGTGGCTGCTGTGGTCTGG - Intergenic
1035287606 7:157816280-157816302 CTCTGCTGCTCGGTGTGGTCGGG + Intronic
1042659188 8:71134917-71134939 CTCTGGTGTCAGCTGGTTTCCGG - Intergenic
1049062372 8:140286284-140286306 CTCTGGAGCCCAGTGTGGTCCGG - Intronic
1053364133 9:37511063-37511085 CTCTTGTGCCCAGTGTTCTCAGG + Exonic
1053439471 9:38104389-38104411 CTCTAGTGCCCGCTGTGCCCAGG - Intergenic
1056760869 9:89414224-89414246 CTCTGGTGACAGCTGTGGACTGG + Intronic
1057333940 9:94141672-94141694 CCCAGGAGCCCGCAGTTGTCTGG - Intergenic
1058530295 9:105899860-105899882 ATCTGGTGACCTCTGTTGTGGGG + Intergenic
1059004141 9:110383510-110383532 GTCTGGTGACCCCTGTTGTGGGG + Intronic
1062262644 9:135670579-135670601 CTCTCGTGCCCGCAGCTCTCTGG + Intergenic
1062498863 9:136843940-136843962 CTCTGGTGTCCGCAGTTGGAAGG - Intronic
1062688806 9:137830357-137830379 CTGGGGTGCCCACTGCTGTCAGG + Intronic
1189274790 X:39777921-39777943 CTGTGGTGCCAGCTTTTGCCAGG - Intergenic
1193018166 X:76759366-76759388 CTCTGGGGACCGCTGTGGGCTGG + Intergenic
1193909099 X:87280467-87280489 GTCTGGTGACCCCTGTTGTGAGG + Intergenic