ID: 901817273

View in Genome Browser
Species Human (GRCh38)
Location 1:11801446-11801468
Sequence GCCCCATGGGAAGGCAGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 0, 2: 34, 3: 245, 4: 909}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901817273_901817282 9 Left 901817273 1:11801446-11801468 CCGTCACTGCCTTCCCATGGGGC 0: 1
1: 0
2: 34
3: 245
4: 909
Right 901817282 1:11801478-11801500 AGAGAAGCATCAATGAAGGTTGG 0: 1
1: 0
2: 0
3: 23
4: 245
901817273_901817281 5 Left 901817273 1:11801446-11801468 CCGTCACTGCCTTCCCATGGGGC 0: 1
1: 0
2: 34
3: 245
4: 909
Right 901817281 1:11801474-11801496 AGTTAGAGAAGCATCAATGAAGG 0: 1
1: 0
2: 1
3: 15
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901817273 Original CRISPR GCCCCATGGGAAGGCAGTGA CGG (reversed) Intronic
900111319 1:1006804-1006826 GCCAGATGGGAAGGCGGGGAAGG + Intergenic
900462841 1:2809660-2809682 GCCACATGGGAAGGAGGTGTGGG + Intergenic
901045967 1:6395914-6395936 GCCCCGGGGGAAGGCAGCTAAGG + Intergenic
901304236 1:8221038-8221060 ACCCCATGGGAAGAGAGTGGTGG + Intergenic
901601452 1:10426500-10426522 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
901817273 1:11801446-11801468 GCCCCATGGGAAGGCAGTGACGG - Intronic
902100408 1:13983303-13983325 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
902365168 1:15968434-15968456 GTCTCATGGGAAGGCAGGCAAGG + Intronic
902710244 1:18234346-18234368 GTCACATGGGAAGGAAGAGAAGG + Intronic
902805639 1:18859654-18859676 GCCCCATGGCTGGGAAGTGATGG + Exonic
902930551 1:19728330-19728352 GCCCCATGGGGTGGTTGTGAGGG + Intronic
903387500 1:22937012-22937034 GCACCTTTGGAAGGCACTGAGGG - Intergenic
903428943 1:23276887-23276909 GACAAATGGGAAGGCAGTGGAGG - Intergenic
903515554 1:23908668-23908690 GGCCCATTGGAAGGGAGGGAGGG + Intronic
904004688 1:27357572-27357594 GCCCCCTGAGAAGGAAGAGAGGG + Exonic
905184070 1:36183757-36183779 GGGCCATGGGAAGCCACTGAAGG + Intergenic
905263644 1:36736341-36736363 GCCCCAAGGAGAGGGAGTGATGG - Intergenic
905375654 1:37518471-37518493 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
905742916 1:40388072-40388094 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
905961922 1:42050184-42050206 GACCTATGGAAAGGCAGGGAGGG - Intergenic
906563494 1:46778659-46778681 GCCCTGTGGGAAGGCAGCTAAGG + Intronic
906642954 1:47452462-47452484 GCACCATGGGAGTGCAGGGATGG - Intergenic
907518032 1:55005829-55005851 ACCTCATGGGGAGTCAGTGATGG + Intronic
907980071 1:59472305-59472327 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
908291363 1:62670109-62670131 GCCCCGTGGGAAGGCAGCCAAGG - Intronic
908333525 1:63096507-63096529 GCTCCTTTGGAAGGCACTGAGGG - Intergenic
908677419 1:66620866-66620888 GCCCCATTGGAAGCCTGTGAAGG - Intronic
908888612 1:68817931-68817953 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
909318020 1:74248048-74248070 GCCCCATGGGGAGGCAGCTGAGG + Intronic
909599643 1:77448267-77448289 GGCCCATGGGAAGCCATGGATGG - Intronic
909904543 1:81178748-81178770 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
910208966 1:84774874-84774896 GCCCCATGAGAAAGCCGTCAGGG - Intergenic
910851825 1:91656242-91656264 GCCACGTGGCAAGGCACTGAAGG + Intergenic
911172773 1:94786371-94786393 ACCCCAAGGTAAGGCAGTTAAGG - Intergenic
911259579 1:95669769-95669791 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
911305213 1:96224479-96224501 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
911564839 1:99451813-99451835 GCCTCTTGAGAAGGCAGAGAAGG - Intergenic
911655045 1:100434428-100434450 GAGCAATGGGAAGTCAGTGAGGG + Intronic
911839226 1:102660153-102660175 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
911954474 1:104217585-104217607 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
912470858 1:109905832-109905854 GCCCCATGTGAAGGAAGGAAAGG - Intergenic
912551952 1:110490348-110490370 GGCCCCTGGTGAGGCAGTGATGG + Intergenic
912923722 1:113894361-113894383 GCCCCTAATGAAGGCAGTGAGGG + Intergenic
913082659 1:115403195-115403217 GACGCTTGGGGAGGCAGTGATGG + Intergenic
913145041 1:115980715-115980737 GCCTCTTGGGAAGGAAGGGAAGG + Intronic
913470205 1:119179244-119179266 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
913692091 1:121289245-121289267 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
914145466 1:144990869-144990891 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
914203413 1:145506011-145506033 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
914438419 1:147680907-147680929 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
914482535 1:148079165-148079187 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
915260076 1:154670970-154670992 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
915261246 1:154678257-154678279 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
915275519 1:154785422-154785444 GGCCCTTGGGAAGGAGGTGAAGG - Intronic
915325007 1:155077320-155077342 GCCCCTTGGGATGGGAGTGGGGG - Intergenic
915431215 1:155868470-155868492 GGCCCATGGGCTGCCAGTGATGG + Exonic
915666087 1:157446423-157446445 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
915764471 1:158349130-158349152 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
915767140 1:158374296-158374318 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
915865530 1:159494749-159494771 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
916219889 1:162433372-162433394 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
916910091 1:169337216-169337238 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
916939046 1:169661393-169661415 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
916940083 1:169668231-169668253 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
916960304 1:169882330-169882352 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
917406356 1:174711616-174711638 GCCCTATGGGGAGGCAGCTAAGG - Intronic
917446342 1:175108598-175108620 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
917578524 1:176349407-176349429 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
917860537 1:179139066-179139088 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
918104204 1:181402424-181402446 GCCTGATGGGAATGAAGTGATGG - Intergenic
918393243 1:184088245-184088267 GCTCCCTGGGCAGGCTGTGAAGG + Intergenic
918708963 1:187703839-187703861 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
918720855 1:187850421-187850443 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
918792017 1:188841316-188841338 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
918853189 1:189718439-189718461 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
918952015 1:191151602-191151624 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
918993905 1:191731990-191732012 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
919091926 1:192987130-192987152 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
919167929 1:193919053-193919075 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
919297754 1:195723054-195723076 GCCCCGTGGGCAGGCAGCTAAGG + Intergenic
920479413 1:206307593-206307615 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
920731349 1:208488578-208488600 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
920756697 1:208739897-208739919 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
920883131 1:209898941-209898963 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
921396361 1:214673287-214673309 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
921801830 1:219410871-219410893 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
921903812 1:220475810-220475832 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
922056848 1:222049965-222049987 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
922423229 1:225472926-225472948 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
922541888 1:226426434-226426456 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
922855816 1:228773924-228773946 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
922985901 1:229865675-229865697 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
923030957 1:230248757-230248779 GCCCCAGGGGAAGGCAATGCTGG - Intronic
923157210 1:231289616-231289638 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
923193438 1:231642089-231642111 GCCCCGCGGGAAGGCAGCCAAGG + Intronic
923324789 1:232871585-232871607 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
923353201 1:233129326-233129348 GCCCCGTGGGGAGGCAGCTAAGG - Intronic
923930055 1:238684771-238684793 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
924117543 1:240762708-240762730 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1063148930 10:3319961-3319983 GCCCCACGGGGAGGCAGTCAAGG + Intergenic
1063321037 10:5053285-5053307 GCCCCATGGGGAGGCAGCTAAGG + Intronic
1063423208 10:5930547-5930569 GCCCCATGGGAGGCCGGAGAGGG + Intronic
1063703819 10:8411136-8411158 GCACAATGGGAAGTCAGTGGAGG + Intergenic
1063921991 10:10942476-10942498 CCCACATGGCAAGGAAGTGAGGG - Intergenic
1064197812 10:13259825-13259847 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1064790338 10:18951420-18951442 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1064990755 10:21254823-21254845 GCCCCAGGGTCAGGCAGTCATGG - Intergenic
1065752157 10:28896961-28896983 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1065802626 10:29366398-29366420 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1065895903 10:30163031-30163053 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1066186326 10:33013511-33013533 GCCCCGCGGGAAGGCAGCCAAGG - Intergenic
1066190287 10:33049445-33049467 GCCCCGCGGGAAGGCAGCCAAGG - Intergenic
1066234065 10:33468253-33468275 GCCCTGTGGGAAGGCAGCTAAGG - Intergenic
1066296114 10:34055731-34055753 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1066567377 10:36734760-36734782 GCCCCGTGGGAAGGCAGCCAAGG + Intergenic
1066598222 10:37076184-37076206 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
1066613589 10:37275465-37275487 GCCCCATGGGGAGGCAGCTGAGG + Intronic
1067044475 10:42976486-42976508 GCCCCCAGGGAAGGCAGGGGTGG + Intergenic
1067691213 10:48503614-48503636 GCACCATGGGATGGTAGGGAAGG - Intronic
1067964106 10:50889458-50889480 GGCCAATGGGAAGGAAGTCACGG + Intergenic
1068460383 10:57321697-57321719 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1068792288 10:61040830-61040852 GCCTCGTGGGGAGGCAGTTAAGG - Intergenic
1068863193 10:61867864-61867886 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1068902136 10:62280597-62280619 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
1068978161 10:63033808-63033830 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1069186502 10:65429549-65429571 GCCCGGTGGGAAGGCAGCTAAGG + Intergenic
1069739367 10:70677717-70677739 GCCCCAGTGGAAGGCAGTCAGGG - Intronic
1069766164 10:70861862-70861884 GCCCCAGGGGAAGGCAGCTAAGG - Intronic
1069867464 10:71512604-71512626 GCCCCATGAGAGGGAAGAGAGGG - Intronic
1070471403 10:76783825-76783847 GCCACATGGCAAGGAAATGAGGG + Intergenic
1070665460 10:78339397-78339419 ACCCTATGGGAAGGCAGAGGGGG + Intergenic
1070942542 10:80359631-80359653 GCCCCGTGGGGAGGCAGTAGAGG + Intronic
1070973405 10:80586095-80586117 GCCCCACGGGGAGGCAGCTAAGG - Intronic
1071003781 10:80859473-80859495 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1071037459 10:81265055-81265077 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1071041071 10:81309216-81309238 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1071332206 10:84571417-84571439 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1071388026 10:85141619-85141641 GCTCCGTGGGAAGGCAGCTAAGG - Intergenic
1071797054 10:89018758-89018780 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
1071900982 10:90119968-90119990 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1072385485 10:94921773-94921795 ACCCCATAGGAAGGGAGAGAAGG + Intergenic
1073065858 10:100758885-100758907 GCTCCTGGGGAAGGCAGTGGAGG + Intronic
1074568485 10:114602884-114602906 GCCCAGAGAGAAGGCAGTGAGGG + Intronic
1074981176 10:118621080-118621102 GCCCCAGAGGAAGGAAGTGAGGG - Intergenic
1074996319 10:118760288-118760310 GCCCCGCGGGAAGGCAGCTATGG + Intergenic
1074999255 10:118783122-118783144 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1075255644 10:120924044-120924066 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1075269358 10:121035480-121035502 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1075307643 10:121382338-121382360 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1075462896 10:122630638-122630660 GGCCCTTGGGAAGGCAGCAAAGG + Intronic
1075537503 10:123283494-123283516 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1075926879 10:126258537-126258559 GCACCAGGGGAAGCCACTGAAGG - Intronic
1076052339 10:127345832-127345854 GGCCCAGGGGAAGGGAGGGATGG + Intronic
1076264857 10:129101723-129101745 GCCGAATGCCAAGGCAGTGAGGG + Intergenic
1076773633 10:132680872-132680894 GCCCCTCGGGAAGGCAGCTAAGG - Intronic
1076796514 10:132801086-132801108 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
1077152263 11:1077628-1077650 ACCCCAAGGGAGGGCAGGGAGGG + Intergenic
1077178813 11:1203255-1203277 GGGCCATGGGCAGGCCGTGAGGG - Intergenic
1077439066 11:2559866-2559888 GTCCCATGGGAAGTCAGGGTGGG + Intronic
1077476835 11:2794464-2794486 GAGAGATGGGAAGGCAGTGAGGG + Intronic
1077764608 11:5144614-5144636 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1078251878 11:9623176-9623198 GCCCCGTGGGAAGGCAGCCAAGG + Intergenic
1078301178 11:10133445-10133467 GCCCCGTGGGAGGGCAGCCAAGG + Intronic
1078514403 11:12009527-12009549 GGCGCAGGGGCAGGCAGTGAAGG - Intronic
1079138288 11:17788938-17788960 GGACCATGGAAAGGCACTGAAGG - Intronic
1079190968 11:18276277-18276299 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
1079730547 11:23934890-23934912 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
1079731734 11:23942419-23942441 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
1080107481 11:28525941-28525963 GCCCCAAGGGGAGGCAGCTAAGG + Intergenic
1080195175 11:29600287-29600309 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1080557671 11:33431884-33431906 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1080688876 11:34538757-34538779 GCCCCCTGGGAAGGGAGAAAAGG - Intergenic
1081125085 11:39312052-39312074 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1081126916 11:39333210-39333232 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
1081315212 11:41623051-41623073 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1081420919 11:42874137-42874159 GCCCGGTGGGAAGGCAGCTAAGG - Intergenic
1081422091 11:42881602-42881624 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1081428409 11:42950105-42950127 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1081940923 11:46941204-46941226 GAACCAGGAGAAGGCAGTGAGGG - Intronic
1082027480 11:47583456-47583478 ACTCTCTGGGAAGGCAGTGACGG + Intronic
1082272138 11:50183492-50183514 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1083408037 11:62472151-62472173 ACGGCATGGGAAGTCAGTGAAGG - Intronic
1083546132 11:63550425-63550447 GCCCCCTGGGAAGGCAGCTAAGG - Intergenic
1084024732 11:66440917-66440939 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1084107431 11:66989013-66989035 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1084861016 11:72018287-72018309 GCCGCATGGTAAGGCTGCGAGGG + Exonic
1085040065 11:73321839-73321861 GGCCAGTGGGAAGGCAGTGGGGG + Intronic
1085245619 11:75098426-75098448 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1085444320 11:76590343-76590365 TCCTCATGGTAAGGCAGTGGGGG - Intergenic
1085470118 11:76752468-76752490 CCCCCTTGGGAAGGCAGCGCTGG + Intergenic
1085671074 11:78465111-78465133 GCCCCACGGGAAGGCAGCTAAGG + Intronic
1086043056 11:82501378-82501400 GCCCTGTGGGAAGGCAGCTAAGG - Intergenic
1087354561 11:97076820-97076842 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1087407294 11:97745759-97745781 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1087966542 11:104422570-104422592 GCCCAATGGGAAGGCAGCTAAGG + Intergenic
1088481695 11:110301079-110301101 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1088570898 11:111222198-111222220 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1088884468 11:113996301-113996323 GCACCATGCGATGGCAATGAAGG + Intergenic
1089062097 11:115634034-115634056 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1089373549 11:117978628-117978650 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1089800262 11:121021879-121021901 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1090183526 11:124721011-124721033 GCAGCATGGGAAGGCACTGAGGG + Intergenic
1090229245 11:125089716-125089738 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1090307664 11:125704843-125704865 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
1090588271 11:128237266-128237288 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1090776703 11:129971973-129971995 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1090782738 11:130021849-130021871 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1091233429 11:134003003-134003025 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1091286313 11:134410543-134410565 ACCCCATGGGAAGAAAGGGAAGG + Intronic
1091402232 12:188258-188280 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1092101682 12:5889032-5889054 GCCCCGTGGGGAGGCAGCTAAGG + Intronic
1092135224 12:6142416-6142438 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1092221421 12:6716256-6716278 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1092272945 12:7037640-7037662 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1092336702 12:7640059-7640081 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1092364077 12:7862405-7862427 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
1092366578 12:7881502-7881524 GCCCCATGGGAAGGCAGCTAAGG - Intronic
1092471790 12:8787486-8787508 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1092472984 12:8794943-8794965 GCCCCATGGGAAGGCGGCTAAGG - Intergenic
1092572397 12:9739717-9739739 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1092617130 12:10225769-10225791 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1092727148 12:11497682-11497704 GCCCAGGGGGAAGGCAGTGAGGG + Intronic
1092834200 12:12472571-12472593 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1093266295 12:17007843-17007865 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1093381591 12:18500365-18500387 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1093527066 12:20115370-20115392 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1093653915 12:21674193-21674215 GCCCCTTGGGGAGGCAGCTAAGG + Intronic
1093793738 12:23286145-23286167 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1094409856 12:30157079-30157101 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1094448746 12:30561853-30561875 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1094589280 12:31805930-31805952 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1094661306 12:32472511-32472533 GCCCCGTGGAAAGGCAGCCAAGG - Intronic
1094666508 12:32525893-32525915 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
1094718175 12:33034072-33034094 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1094833216 12:34309911-34309933 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1096478515 12:51923176-51923198 GCCCAATGGCCAGGGAGTGAAGG + Intronic
1097128918 12:56795980-56796002 GTCCCATGGGAAGGCAGCCAAGG + Intergenic
1097253702 12:57655986-57656008 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1097664178 12:62461417-62461439 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1097863862 12:64543352-64543374 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1098168197 12:67719373-67719395 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1098759262 12:74403166-74403188 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1099191409 12:79565171-79565193 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1099450562 12:82802159-82802181 GCCCCGTGGGGAGGCAGCTAAGG + Intronic
1099559600 12:84155262-84155284 GCCCCATGGAAAGGCAGCTAAGG + Intergenic
1099716209 12:86296543-86296565 GCCCGGTGGGAAGGCAGCTAAGG + Intronic
1099790732 12:87330435-87330457 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1100211863 12:92406659-92406681 GCCCCGAGGGAAGGCAGCTAAGG + Intergenic
1100521476 12:95379804-95379826 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1100584716 12:95969354-95969376 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1101021646 12:100559601-100559623 GCCCCTCGGGAAGGCAGCTAAGG - Intronic
1101426319 12:104591381-104591403 GCCCAAGGGGAAGGCGATGATGG + Intronic
1101461941 12:104905653-104905675 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1101541879 12:105672696-105672718 GCCCAGTGGGAAGGCAGCCAGGG - Intergenic
1102387228 12:112520073-112520095 GCTCCACGGGAAGGCAGCTAAGG + Intergenic
1103146123 12:118597316-118597338 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1103402957 12:120655584-120655606 TCCCCGCTGGAAGGCAGTGAGGG - Intronic
1103526068 12:121569385-121569407 TCCCCATGGGAGGGTAGGGAGGG - Intronic
1103668569 12:122592244-122592266 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
1103783373 12:123414254-123414276 GCCCCACGGGAAGGCAGCTAAGG + Exonic
1104426465 12:128682255-128682277 GCTCCATGGGATGACAGTGGGGG + Intronic
1104582658 12:130022274-130022296 GCCGCGTGGGAAGGCAGCTAAGG - Intergenic
1104614496 12:130256795-130256817 GCCGCGTGGGAAGGCAGCTAAGG + Intergenic
1105347559 13:19587970-19587992 GCCCCAAGGCAAGGCTGTGCTGG - Intergenic
1105722194 13:23127791-23127813 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1105876664 13:24560846-24560868 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1106221304 13:27748455-27748477 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1106617045 13:31339807-31339829 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1106810970 13:33358200-33358222 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
1107447157 13:40479702-40479724 GCCCCATGTGACGCCCGTGAGGG + Intergenic
1107590442 13:41898719-41898741 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1107652598 13:42559945-42559967 GCCCCAAGGGAAGGCAGCTAAGG - Intergenic
1108099158 13:46936196-46936218 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1108285113 13:48898949-48898971 GCACTATGGGGAGGCACTGAAGG - Intergenic
1108435366 13:50396814-50396836 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1108469438 13:50753448-50753470 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1108851594 13:54737417-54737439 GCCCTGTGGGAAGGCAGCCAAGG + Intergenic
1108858938 13:54829641-54829663 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1109007785 13:56900949-56900971 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1109124694 13:58504410-58504432 GCCCCGCGGGAAGGCAGCAAAGG + Intergenic
1109141070 13:58714302-58714324 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1109446590 13:62448040-62448062 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1109563147 13:64077678-64077700 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1109741540 13:66561240-66561262 GCCCTGTGGGAAGGCAGCTAAGG - Intronic
1110368890 13:74718608-74718630 GCCCCGTGGGAAAGCAGTTAAGG - Intergenic
1110417503 13:75268668-75268690 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1110792376 13:79600299-79600321 GCCCCGTGGGAAAGCAGCTAAGG + Intergenic
1110862159 13:80355766-80355788 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1110874347 13:80490703-80490725 GCCCCAGGGGAAGGCAGTTAAGG + Intergenic
1110940275 13:81340912-81340934 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1110999822 13:82165091-82165113 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
1111006665 13:82258179-82258201 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1111441927 13:88292039-88292061 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1111591044 13:90348818-90348840 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1112589201 13:100748413-100748435 CCTCCATGGGAGGGCTGTGATGG - Intergenic
1112613117 13:100975915-100975937 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1112705873 13:102068693-102068715 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1113538112 13:111084013-111084035 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1113678075 13:112221936-112221958 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1114155567 14:20099417-20099439 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1114536917 14:23428775-23428797 CCTCCATGTCAAGGCAGTGAAGG + Intronic
1114560287 14:23585022-23585044 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1114593557 14:23891976-23891998 CCCCCACGGGAAGGCAGCTAAGG - Intergenic
1115437192 14:33388159-33388181 GCCCTGTGTGAATGCAGTGAAGG + Intronic
1116114484 14:40629781-40629803 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1116251015 14:42482533-42482555 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1116390545 14:44384962-44384984 GCCTCACGGGAAGGCAGCTAAGG - Intergenic
1116452382 14:45080656-45080678 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
1117302533 14:54443271-54443293 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1117571904 14:57056756-57056778 GCCCCGTGGTAAGGCAGCTAAGG + Intergenic
1117784782 14:59271315-59271337 TCCCAATGAGAAGGTAGTGATGG + Intronic
1117953136 14:61102660-61102682 GCCTCATGGGGAGGCATGGACGG + Intergenic
1118306338 14:64658343-64658365 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1119038866 14:71254517-71254539 GCCCCACGAGAAGGCAGCTAAGG - Intergenic
1119486801 14:74994368-74994390 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1119673429 14:76536891-76536913 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1119870682 14:78014121-78014143 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1120253766 14:82092031-82092053 CCCCCAGGGCAATGCAGTGAGGG + Intergenic
1120331004 14:83092604-83092626 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1120439090 14:84513050-84513072 GCCCCAAGGGAAGGCAGCTAAGG + Intergenic
1121504517 14:94466367-94466389 GCCCCACGGGAGGGCAGGAAAGG - Intronic
1122493436 14:102135652-102135674 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1122612101 14:102992123-102992145 GACCCCTGGGGAGGGAGTGATGG + Intronic
1123949109 15:25253334-25253356 GCCCCGAGGGAAGGCAGCTAAGG + Intergenic
1123982830 15:25619593-25619615 GCCCCATATGCAGGTAGTGAAGG - Intergenic
1124114834 15:26831320-26831342 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1124198570 15:27656588-27656610 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
1124387839 15:29224933-29224955 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1124573147 15:30883976-30883998 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1124905368 15:33863091-33863113 GTGCCATGGGAAGGCACAGAAGG - Intronic
1125112239 15:36047174-36047196 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1125298876 15:38233207-38233229 GGCCGATGGGAAAGCAATGAAGG + Intergenic
1125480270 15:40074914-40074936 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1125565732 15:40677068-40677090 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1125883835 15:43214014-43214036 GCCCCGTGGCAAGGCAGGGCTGG - Intronic
1126089015 15:45035054-45035076 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1126899229 15:53295057-53295079 GCCACATGGAAAGGCCCTGAAGG - Intergenic
1127198690 15:56619443-56619465 GCACTTTGGGAAGCCAGTGAGGG - Intergenic
1127984797 15:64061103-64061125 GCCCCGTGGGGAGGCAGCTAAGG - Intronic
1127998759 15:64171679-64171701 GCCCTATGGGCAAGCAGTGGAGG + Exonic
1128114044 15:65094430-65094452 GCCCCAGGGGATGGAAGGGATGG - Intronic
1128598552 15:68975810-68975832 GCCCCACGGGGAGGCAGCTAAGG + Intronic
1128604210 15:69024069-69024091 GCCCCAGGGTAAGACATTGATGG - Intronic
1128669961 15:69567499-69567521 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1128813285 15:70587313-70587335 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1129196946 15:73973928-73973950 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1129373995 15:75116137-75116159 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1129727542 15:77909257-77909279 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1129777478 15:78246278-78246300 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1129840341 15:78739708-78739730 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130132886 15:81158842-81158864 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1130209401 15:81909537-81909559 GACCCAAGGGAAGGCAGGGAGGG + Intergenic
1130258558 15:82337283-82337305 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130270123 15:82441799-82441821 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130275848 15:82476042-82476064 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130468207 15:84203434-84203456 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130474086 15:84248042-84248064 GACCCTAGGGAAGGCAGGGAGGG + Intergenic
1130481501 15:84362110-84362132 GACCCTAGGGAAGGCAGGGAGGG + Intergenic
1130490213 15:84425673-84425695 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130496057 15:84470108-84470130 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130590500 15:85208032-85208054 GACCCTGGGGAAGGCAGGGAGGG - Intergenic
1130596365 15:85252677-85252699 GACCCTGGGGAAGGCAGGGAGGG + Intergenic
1130972127 15:88741641-88741663 GCCACCTGAGAAGGCAGTAAAGG - Intergenic
1131012693 15:89031841-89031863 ACCCCACGGGAAGGCAGCTAAGG + Intergenic
1131190294 15:90310002-90310024 GACCCATGGGAGAGGAGTGATGG + Intronic
1131263761 15:90903508-90903530 GCCCCCTGGGAAGGGAGAGACGG - Intronic
1131450754 15:92537736-92537758 GAGCCATGGGAAGCCATTGAAGG + Intergenic
1131466296 15:92657004-92657026 GCCCCATGCCAAGGAACTGAGGG - Intronic
1131507809 15:93032047-93032069 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1131992369 15:98104407-98104429 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1132221596 15:100109284-100109306 GCCACAGGGGAAGACAGTGCAGG + Intronic
1132294689 15:100726477-100726499 GCCCCATGGTGAGTCAGTGAGGG - Intergenic
1132679321 16:1133270-1133292 CCCCCAGGTGAAGGGAGTGAGGG + Intergenic
1133362636 16:5186506-5186528 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1135274635 16:21101764-21101786 GCCCCAGGGCCAGGCAGGGAGGG + Intronic
1135280874 16:21152817-21152839 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1135751042 16:25059051-25059073 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1136068447 16:27774202-27774224 GCACCAGGGGAAGGCAGAAAAGG - Intronic
1137397572 16:48126958-48126980 GGCACATGGGAAGGCAGGGCGGG + Intronic
1137765541 16:50975060-50975082 ACCCCATGGGAAGCTGGTGATGG - Intergenic
1137945712 16:52731628-52731650 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1138520123 16:57566227-57566249 TCCCCATGGGGAGGAAGGGAAGG + Intronic
1138938255 16:61757708-61757730 CTCCCTTGGAAAGGCAGTGATGG + Intronic
1139125518 16:64072469-64072491 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1139147757 16:64344114-64344136 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1139512220 16:67433992-67434014 GCTCCATGGGCAGCCAGTGAGGG - Intronic
1140722498 16:77784527-77784549 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1141291486 16:82722025-82722047 GGCCCATCGGGAGGCAGGGATGG + Intronic
1141400137 16:83740257-83740279 ACCCCATGGGAAGTCATTGGTGG + Intronic
1141564421 16:84891758-84891780 GCCCCTGGGGAGGGCAGGGATGG + Intronic
1141609783 16:85174821-85174843 GCCCCCTGGGGAGGGAGAGAGGG + Intronic
1142207434 16:88790826-88790848 GCCACAGAGGCAGGCAGTGATGG - Intergenic
1142505688 17:361813-361835 GCCCCGTGGGAAGGCAGCCAAGG - Intronic
1143104154 17:4520038-4520060 GTCCCAAGGGAAGACACTGAGGG + Intronic
1143127973 17:4656693-4656715 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1143135256 17:4709234-4709256 GCCCCGAGGGAAGGCAGCTAAGG + Intergenic
1143173669 17:4944645-4944667 GGGGCATGGGCAGGCAGTGAGGG - Intronic
1143200730 17:5111555-5111577 GACCCTTGGGTAGGGAGTGAAGG - Intronic
1143460503 17:7100739-7100761 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1143742891 17:8966681-8966703 GCCCCTGGGGAAGGGAGTGAGGG + Intergenic
1143850092 17:9804425-9804447 GGCCCATTGGAAGGCAGGGAAGG + Intronic
1143873609 17:9975454-9975476 GCCCGAAGGGAAGGGAGGGAGGG - Intronic
1143884153 17:10053547-10053569 GCCCCATGGGAAGGGAGCCCAGG + Intronic
1143930865 17:10422357-10422379 GGCCCAAGGGAATGCAGTGGGGG - Intergenic
1144547784 17:16214413-16214435 GCACCCTGGTGAGGCAGTGATGG - Intronic
1144698145 17:17319706-17319728 GCCCCAGGGGCAGGGAGGGACGG + Intronic
1144703626 17:17353750-17353772 ACCCCATGGGAAGGTAGGGCAGG + Intergenic
1145265952 17:21379652-21379674 GCCCCACGGGATGGCTGTGCCGG + Intronic
1146384723 17:32359654-32359676 GCACTATGGGCAGGCAGTGCAGG + Intronic
1146600044 17:34206168-34206190 GTCCCAAGGGAAGGAAGAGATGG - Intergenic
1146740446 17:35279055-35279077 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1147431839 17:40376054-40376076 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1147635347 17:41960651-41960673 GTCCCATGAGGAGTCAGTGAGGG - Intronic
1147679186 17:42229003-42229025 GCGCCTTGAGAAGGCAGTTAAGG + Intronic
1147837745 17:43347086-43347108 GCCCCAGCGGAAGGCAGTTGTGG + Intergenic
1148016896 17:44528194-44528216 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1148366156 17:47057423-47057445 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1149661971 17:58338712-58338734 GCCTCGTGGGATGGCACTGAGGG + Intergenic
1150246883 17:63682681-63682703 GCCCCATGGCAAGGAACTGCAGG - Intronic
1150331354 17:64296977-64296999 GGGCAATGGGAAGCCAGTGAAGG - Intergenic
1150788291 17:68180068-68180090 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1150792250 17:68208034-68208056 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1150804589 17:68309050-68309072 GCCCCACAGGAAGGCAGCTAAGG + Intronic
1151372361 17:73656285-73656307 GACCCCTGGGCAAGCAGTGATGG - Intergenic
1151375994 17:73689473-73689495 GGGCAATGGGAAGGCACTGAAGG + Intergenic
1151438493 17:74113472-74113494 GCCCCGCGGGGAGGCAGTTAAGG + Intergenic
1151782655 17:76257788-76257810 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1152007892 17:77694004-77694026 GCCCCCTGGGAAGCGAGGGAAGG + Intergenic
1152027215 17:77818447-77818469 GCCCCATGGGATGGCTGAAACGG - Intergenic
1152168246 17:78724773-78724795 CCCCCATGGCATGGCAGTGGAGG - Intronic
1152619031 17:81352188-81352210 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1153528455 18:6019941-6019963 GCACCCTGGGAACGCAGAGATGG - Intronic
1153644035 18:7178806-7178828 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1153832442 18:8935563-8935585 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1154110281 18:11562065-11562087 GCCCAATGGGAAGGTGATGATGG - Intergenic
1155195337 18:23469029-23469051 GCCCCATGGCAAGGAACTGCAGG - Intronic
1155208027 18:23577770-23577792 GCCCCGTGGGAAGGCAGCCAAGG + Intronic
1155772894 18:29723737-29723759 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1155976789 18:32140042-32140064 GCCCTGTGGGAAGGCAGCCAAGG - Intronic
1156038692 18:32794794-32794816 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1156243024 18:35271795-35271817 GCCCCATGGGGAGGCGGCTAAGG + Intronic
1156267030 18:35498304-35498326 TCCGCGTGGGAAGGCAGGGAGGG - Intergenic
1156610483 18:38718569-38718591 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1156718042 18:40036130-40036152 ACCCCATAGGAAGCCAGTGGGGG - Intergenic
1157979782 18:52367044-52367066 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1158705733 18:59790592-59790614 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1158894686 18:61901699-61901721 ACCCACTGGGAAGGCAGGGAAGG - Intergenic
1159167932 18:64725779-64725801 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1159230823 18:65605474-65605496 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1159656084 18:71031478-71031500 GCCCCTTGGGAAGGCAGCCAAGG + Intergenic
1159860887 18:73647936-73647958 GGCCCATGGGCAGGAGGTGAGGG - Intergenic
1160176600 18:76600270-76600292 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1160552746 18:79705438-79705460 GTCCCATGTGGATGCAGTGAGGG + Intronic
1160993203 19:1869518-1869540 ACCACAAGGGAAGCCAGTGAAGG + Intergenic
1161795113 19:6381846-6381868 GCCCCCTGGGAAGGGAGGAAAGG + Exonic
1162107017 19:8375984-8376006 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1162127714 19:8508255-8508277 GGGCCATGGGAAGCCACTGAAGG + Intergenic
1162230167 19:9259733-9259755 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1162233090 19:9283594-9283616 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1162237664 19:9321613-9321635 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1162262037 19:9541467-9541489 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1162324957 19:9993488-9993510 GCCCCCTGGGAAGGCAGATGGGG + Intronic
1162632682 19:11941436-11941458 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1162814706 19:13186845-13186867 GCCCCACGGAAAGGCAGCTAAGG + Intergenic
1163151687 19:15418794-15418816 GACCGCAGGGAAGGCAGTGACGG + Intronic
1163181703 19:15608785-15608807 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1163218868 19:15899906-15899928 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1164144012 19:22499129-22499151 GCCCCACAGGAAGGCAGCTAAGG + Intronic
1164270565 19:23668667-23668689 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1164309137 19:24030961-24030983 GCCCCATGTGGAGGAAGGGATGG - Intergenic
1164513047 19:28912791-28912813 GCACCATGAGATGGCAATGAAGG - Intergenic
1164776199 19:30855569-30855591 GCCACATGGGAAGGCAGGCCAGG - Intergenic
1165036397 19:33036815-33036837 GCCCCACGGGAAGGCAGCTAAGG - Intronic
1165073864 19:33270091-33270113 GCTCCATGGGGAGACAGTGAGGG + Intergenic
1165335311 19:35165808-35165830 CCCCACTGGGAAGGGAGTGAAGG + Intronic
1165415517 19:35691242-35691264 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1165792588 19:38500805-38500827 GCCCCATCTGCAGGCAGGGAGGG - Exonic
1165921891 19:39304186-39304208 GGGCCATGGGAAGCCAATGAAGG - Intergenic
1166036200 19:40170281-40170303 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1166649702 19:44563345-44563367 GCCCCGTGGGAAGGCAGCCAAGG + Intergenic
1166835300 19:45664080-45664102 TCCACAGAGGAAGGCAGTGAGGG - Intergenic
1167095226 19:47371866-47371888 GCACTATGGAAAGTCAGTGAAGG + Intronic
1167569351 19:50277116-50277138 TCCACAAGGGAAGGCAGTGCTGG - Intronic
1167707672 19:51091187-51091209 GACCCAAGGGAAGACAGAGACGG - Intergenic
925537788 2:4935454-4935476 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
925929220 2:8694021-8694043 GTCCCACCTGAAGGCAGTGAGGG + Intergenic
926334054 2:11850083-11850105 GCCCCGTGGGAAGGTCTTGATGG + Intergenic
926444522 2:12926693-12926715 GCCCCGTAGGAAGGCAGCTAAGG + Intergenic
926685822 2:15696915-15696937 GCCCCACGGGAAGGCAGCTGAGG + Intronic
926850667 2:17193731-17193753 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
927430834 2:23025018-23025040 GTCCCATGGGAAGACATGGACGG - Intergenic
927510731 2:23642469-23642491 CCCACGTGGGGAGGCAGTGAGGG - Exonic
927863776 2:26576225-26576247 CCACCACGGGAAGGGAGTGATGG + Intronic
927900438 2:26814647-26814669 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
927955386 2:27204221-27204243 GCCCAATGGGGAGTCAGTAAGGG + Intronic
928411894 2:31060745-31060767 TCTCCAAGGGAAGCCAGTGAGGG + Intronic
928493102 2:31803923-31803945 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
928753213 2:34494513-34494535 GCCCCGTAGGAAGGCAGCCAAGG - Intergenic
929344829 2:40869187-40869209 TCCCAATGACAAGGCAGTGATGG - Intergenic
929379706 2:41335810-41335832 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
929418514 2:41767908-41767930 TCCACATGGGAAGGAACTGAGGG - Intergenic
929890850 2:45917812-45917834 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
930468203 2:51780452-51780474 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
930485530 2:52007019-52007041 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
930854763 2:56002572-56002594 GCTCCATGGGAAGGCATGGATGG + Intergenic
931831346 2:66054686-66054708 AGGCCATGGGAAGGCATTGAAGG - Intergenic
932359501 2:71092628-71092650 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
932521789 2:72422047-72422069 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
933065719 2:77792997-77793019 GCCCCCTGGTTTGGCAGTGAAGG + Intergenic
933487234 2:82938586-82938608 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
933511454 2:83246109-83246131 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
934898514 2:98139223-98139245 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
934979670 2:98829488-98829510 GGCCCATGGGGAGGAGGTGAGGG + Intronic
935052580 2:99536304-99536326 GCCCCCTCTGAAGGCTGTGAGGG + Intergenic
935223033 2:101031327-101031349 GTCAGCTGGGAAGGCAGTGATGG - Intronic
935341117 2:102060769-102060791 GGCACATGGGCAGGAAGTGAAGG - Intergenic
936172692 2:110190372-110190394 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
937181159 2:119997205-119997227 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
937209577 2:120259891-120259913 GCCCCGTGGGAAGGCAGCCAAGG + Intronic
937226872 2:120375293-120375315 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
937596867 2:123683993-123684015 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
937746616 2:125422468-125422490 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
937920015 2:127122294-127122316 TCTCCTTGGGGAGGCAGTGAGGG - Intergenic
937976965 2:127588331-127588353 TCCCCATGGGTGGGCAGTGATGG + Intronic
938401047 2:130991665-130991687 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
938870205 2:135467485-135467507 ACCCCCTGGGAGGGCAGAGATGG - Intronic
939053196 2:137331748-137331770 GCCCCGAGGGAAGGCAGCTAAGG + Intronic
939229779 2:139410560-139410582 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
939260552 2:139802828-139802850 GAACCATGGGAAGGAGGTGATGG - Intergenic
939275184 2:139990841-139990863 GCCCCATGGGAAAGCAGCTAAGG + Intergenic
939465149 2:142546280-142546302 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
939777339 2:146403832-146403854 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
939972526 2:148678541-148678563 GCCACACGGGAAGGCAGCTAAGG + Intronic
940215106 2:151296176-151296198 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
940784593 2:157968055-157968077 GTCCCGTGGGAAGGCAGCTAAGG + Intronic
941240104 2:163026495-163026517 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
941309804 2:163913833-163913855 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
941355147 2:164482178-164482200 GGGCCATGGAAAGCCAGTGATGG - Intergenic
941705851 2:168657579-168657601 GCCCCGTGGGAAGGCAGCCAAGG + Intronic
941712105 2:168725038-168725060 GCCCCATGGGAAGGCAGCTAAGG + Intronic
941721781 2:168820220-168820242 GGCACATAGGAAGGAAGTGATGG - Intronic
941820813 2:169841753-169841775 GCCCCGCGGGAAGGCAGCCAAGG - Intronic
942183737 2:173404700-173404722 CCCCCAAGGAAAGGCAGTTAAGG - Intergenic
943166062 2:184327832-184327854 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
943228340 2:185210176-185210198 GGCACAAGGGATGGCAGTGATGG + Intergenic
943494733 2:188606535-188606557 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
943680320 2:190761095-190761117 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
943835179 2:192508188-192508210 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
943941427 2:194002881-194002903 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
944843130 2:203643013-203643035 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
944857916 2:203785715-203785737 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
945401403 2:209387554-209387576 GCCCCTTGGGGAGGCAGCTAAGG - Intergenic
945575457 2:211524518-211524540 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
945745800 2:213718711-213718733 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
945870232 2:215219277-215219299 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
945872808 2:215245869-215245891 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
945950429 2:216034343-216034365 GCCCGAGGGGAAGGCAGTGATGG - Intronic
947026650 2:225744353-225744375 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
947151844 2:227123585-227123607 GCCCTAGGGGAAGGGAGTGGGGG + Intronic
947491019 2:230594326-230594348 GCCCCAGGGGCAGACAGTGGTGG + Intergenic
947932038 2:233972609-233972631 GCCCCACGGGAAGGCAGCTACGG + Intronic
948449089 2:238057994-238058016 GCCCCACGGGGAGGCAGCTAAGG + Intronic
948935773 2:241163479-241163501 GCCAATTGTGAAGGCAGTGAAGG - Intronic
1169374691 20:5057097-5057119 CTCCCATGAGAAGGAAGTGAGGG - Intergenic
1169645337 20:7803701-7803723 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1169814434 20:9641729-9641751 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1170246489 20:14226727-14226749 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1170806830 20:19639771-19639793 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1170989905 20:21292091-21292113 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1171250047 20:23639814-23639836 GACCCATTGGCAGGCAGTGGGGG + Intergenic
1171318833 20:24220861-24220883 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1172431839 20:34898943-34898965 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1173620578 20:44432741-44432763 GCCCCATCAGGCGGCAGTGATGG - Exonic
1173656012 20:44700809-44700831 ACCCCAGAGGAAGGCATTGAAGG + Intergenic
1173831529 20:46092070-46092092 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1174446557 20:50594843-50594865 GTCACATGGGAATGCAGGGAAGG - Intronic
1174589674 20:51635200-51635222 CCCTCGTGGGAAGGCACTGAGGG + Intronic
1175254169 20:57629009-57629031 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1175481436 20:59314036-59314058 GCCTCCTGGGAAGGAAGGGATGG + Intronic
1175594981 20:60223863-60223885 ACCCCCTGGGAAGGCGGTGAGGG - Intergenic
1175623484 20:60470501-60470523 GCCACATGAGAAGGCCCTGAGGG + Intergenic
1175707150 20:61188195-61188217 GAGCAATGGGAAGCCAGTGAGGG - Intergenic
1176344820 21:5733657-5733679 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1176351634 21:5854241-5854263 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1176500007 21:7590798-7590820 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1176539141 21:8131727-8131749 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1176558092 21:8314772-8314794 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1176671058 21:9735758-9735780 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1176966597 21:15218716-15218738 GCCCCGCGGGAAGGCAGCCAAGG + Intergenic
1177565812 21:22818999-22819021 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1178048593 21:28723850-28723872 ACACCATGGCAAGGCAGTGCTGG - Intergenic
1178074190 21:29000357-29000379 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1178398762 21:32265551-32265573 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1178585625 21:33868457-33868479 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1178805451 21:35835626-35835648 TCCCACTGGGAAGGCACTGAGGG - Intronic
1178983331 21:37283325-37283347 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1178985383 21:37298658-37298680 GTCCCCTGGGAAGGGAGGGATGG + Intergenic
1179036062 21:37759564-37759586 GGACAATGGGAAGCCAGTGATGG - Intronic
1180149988 21:45942497-45942519 TCCCCAGGGGAAGGAAGTGCCGG - Intergenic
1180741023 22:18053497-18053519 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1180906139 22:19413276-19413298 GCTCCAGGGGAAGGCAGGGATGG + Intronic
1181904463 22:26183026-26183048 GACCCCTGGGAAGGCTGAGAAGG + Intronic
1182353305 22:29710842-29710864 GCCCCATTGGGAGGCAGTGGGGG - Intergenic
1182479404 22:30597083-30597105 GCCCCACGGGGAGGCAGCTAAGG - Intronic
1182745229 22:32600594-32600616 GCCCCACGGGAAGACCGTGGTGG - Intronic
1183422100 22:37717980-37718002 GCCCGGTGGGAAGGCAGCTAAGG + Intronic
1183685256 22:39357819-39357841 GCCCCGAGGGAAGGCAGCTAAGG - Intronic
1184515194 22:44957424-44957446 GCCCCAGAGGAAGGCTGTGAGGG - Intronic
1184584276 22:45436948-45436970 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1184749171 22:46474352-46474374 GCCCGAGGGGATGGCAGTGGTGG - Intronic
1184906232 22:47488447-47488469 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1185118825 22:48953435-48953457 GCCCCATAATAATGCAGTGAGGG + Intergenic
1185220854 22:49628479-49628501 GCCGCCCTGGAAGGCAGTGATGG - Intronic
1185291908 22:50031498-50031520 GCCCCATGGGAGAGCAGGGCAGG + Intronic
1203244091 22_KI270733v1_random:48082-48104 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
949258994 3:2083847-2083869 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
949900706 3:8812722-8812744 GCCCCACAGAAAGGCAGGGAGGG - Intronic
950256637 3:11511736-11511758 GCCCCGAGGGAAGGCAGCTAAGG + Intronic
950421023 3:12899573-12899595 GGACCATGGGAAGGCAGCGGGGG + Intronic
950470178 3:13179932-13179954 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
950474995 3:13209565-13209587 GGCACATGGGAGGGCAGGGAGGG - Intergenic
950600358 3:14029635-14029657 GCCCCACGGGAAGGCAGCTAAGG + Intronic
950929414 3:16773936-16773958 GTCCCATGGGAAGGCAGCTAAGG - Intergenic
951332938 3:21387393-21387415 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
952177382 3:30879756-30879778 GCCTCATGGGTAGCCATTGAAGG + Intronic
952360492 3:32625853-32625875 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
952398251 3:32939903-32939925 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
952713328 3:36453522-36453544 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
952730662 3:36634127-36634149 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
953089848 3:39713535-39713557 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
953124493 3:40078067-40078089 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
953307590 3:41844309-41844331 GCCCCATGGGAAGGCAGCTAAGG + Intronic
953369749 3:42377273-42377295 ACCCCATAGGCAGACAGTGAGGG - Intergenic
953674061 3:44986269-44986291 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
954226184 3:49182806-49182828 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
954673491 3:52303192-52303214 GCCCCAGGGCAAGGCAGAGGCGG + Intergenic
955183373 3:56692099-56692121 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
955449504 3:59051077-59051099 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
956045396 3:65190665-65190687 GAGCCATGGGAAGTCATTGAAGG - Intergenic
956195755 3:66651747-66651769 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
956481477 3:69677673-69677695 GCCCCAAGGGAAGGCAGCTAAGG - Intergenic
956563644 3:70612032-70612054 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
956809315 3:72848798-72848820 GCCCCATAGAAATGCTGTGAGGG + Intronic
956855279 3:73269413-73269435 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
957002254 3:74900117-74900139 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
957277485 3:78108608-78108630 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
957362097 3:79173544-79173566 GCCCTGTGGGAAGGCAGATAAGG - Intronic
957419648 3:79951511-79951533 GCCCCCCGGGAAGGCAGCTAAGG + Intergenic
957556276 3:81767527-81767549 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
957560147 3:81812149-81812171 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
957804886 3:85134001-85134023 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
957829994 3:85504816-85504838 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
957921842 3:86757821-86757843 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
957995125 3:87679318-87679340 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
958073198 3:88641220-88641242 TCGCCAGGAGAAGGCAGTGAAGG + Intergenic
958810748 3:98858111-98858133 GCCCCACGGGGAGGCAGCTAAGG + Intronic
959422760 3:106148847-106148869 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
959575559 3:107929199-107929221 GTGCCATGGGAAGGCACTGAAGG - Intergenic
960149783 3:114238430-114238452 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
960199393 3:114812837-114812859 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
960282159 3:115791782-115791804 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
960745423 3:120882592-120882614 ACCACATGGGAAGGAAATGAAGG - Intergenic
960868583 3:122227362-122227384 GCCCCACGGGGAGGCAGCTAAGG + Intronic
961745065 3:129059438-129059460 GCTCCATGGGGAGGGAGGGAAGG + Intergenic
961874405 3:130010816-130010838 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
962153831 3:132922875-132922897 GGCCGATGGGAAGGAAGTGCAGG - Intergenic
962263684 3:133930779-133930801 GGCCCATGGGAGGGAAGTGGGGG - Intergenic
962283733 3:134070401-134070423 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
962352770 3:134667707-134667729 ACCCCTTGAGAAGGCAGAGATGG + Intronic
962398734 3:135039569-135039591 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
962600482 3:136987728-136987750 GCCCCACGGGAAGGCAGCTAAGG + Intronic
962671676 3:137714663-137714685 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
962758269 3:138484869-138484891 GCCCTGTGGGAAGGCAGCTAAGG - Intergenic
962998147 3:140651600-140651622 GCCCCATGAGGAGGCAGCTAAGG - Intergenic
963063223 3:141241685-141241707 GCCCCATGGCACAGCAGTGTTGG - Intronic
963440424 3:145333598-145333620 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
963533286 3:146497518-146497540 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
963583360 3:147154306-147154328 GCCCCATGGGAAGGCGGCTGAGG - Intergenic
963651807 3:147989521-147989543 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
963742997 3:149098034-149098056 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
963744171 3:149109568-149109590 GCCCCACGGGAAGGCAGCTGAGG - Intergenic
963760603 3:149284199-149284221 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
963846142 3:150159840-150159862 ACCCCCAGGGAAGGCAGGGAAGG + Intergenic
963862192 3:150323188-150323210 GCCCCGCGGGAAGGCAGTTAAGG - Intergenic
964032338 3:152152637-152152659 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
964139198 3:153378476-153378498 GCCCCGTGGAAAGGCAGCTAAGG + Intergenic
964378534 3:156073337-156073359 GCCCCATGGGGAGGCAGCTAAGG - Intronic
964381109 3:156099644-156099666 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
964393763 3:156224062-156224084 GCCCCGTGGGGAGGCAGCTAAGG + Intronic
964444023 3:156740798-156740820 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
964452125 3:156822817-156822839 GCTCCACGGGAAGGCAGCTAAGG + Intergenic
964802876 3:160574129-160574151 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
964974194 3:162599918-162599940 GCCCCGCGGGAAGGCAGCCAAGG - Intergenic
964977776 3:162640290-162640312 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
964982487 3:162703065-162703087 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
964983135 3:162710650-162710672 GCCCCATAGGGAGGCAGCTAAGG + Intergenic
965003536 3:162987534-162987556 GACCCACGGGAAGGCAGCTAAGG - Intergenic
965040316 3:163499242-163499264 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
965078013 3:164003188-164003210 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
965109403 3:164402030-164402052 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
965200325 3:165649457-165649479 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
965220195 3:165918589-165918611 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
965245220 3:166258608-166258630 GCCCGACGGGAAGGCAGCTAAGG + Intergenic
965288064 3:166843032-166843054 GCCCCACGGGAAGGCAGTTAAGG - Intergenic
965298151 3:166976054-166976076 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
965446481 3:168780316-168780338 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
965753210 3:171999011-171999033 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
966096769 3:176213560-176213582 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
966190995 3:177271869-177271891 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
966725024 3:183101117-183101139 GCCCCGTGGGAAGGCAGCCAAGG - Intronic
967448525 3:189596344-189596366 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
967499132 3:190177189-190177211 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
967718374 3:192789252-192789274 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
969654955 4:8491550-8491572 GCCCCATGGAAAGGCAGCTAAGG + Intronic
969795471 4:9524598-9524620 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
970558610 4:17260514-17260536 GCCACATGGCAAGGAACTGAGGG - Intergenic
970576850 4:17436706-17436728 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
970673145 4:18418478-18418500 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
970803550 4:20004232-20004254 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
970817872 4:20179173-20179195 TCCCCATGGGGAGGCAGCTAAGG + Intergenic
971480354 4:27109230-27109252 GCCCCAGGGGAAGTCACTCAAGG - Intergenic
971553019 4:27978475-27978497 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
971639846 4:29117574-29117596 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
971709487 4:30092927-30092949 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
971905175 4:32716365-32716387 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
972022764 4:34335781-34335803 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
972034783 4:34506761-34506783 GCCCCATGGTAAGGCAGCTAAGG + Intergenic
972392573 4:38627123-38627145 GCCCCTTGGGAAGGCAGCTAGGG - Intergenic
972505763 4:39718641-39718663 GCCCCGTGGGGAGGCAGCTAAGG + Intronic
972890491 4:43551434-43551456 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
972900148 4:43672578-43672600 GCCCTGTGGGAAGGCAGCTAAGG - Intergenic
973190293 4:47378191-47378213 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
973308099 4:48675561-48675583 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
973587745 4:52409886-52409908 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
973817604 4:54632757-54632779 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
973852594 4:54976170-54976192 GCCCCCTGGTTTGGCAGTGAAGG - Intergenic
974009656 4:56595052-56595074 GCCCCATGGGGCCGCACTGACGG - Intronic
974128935 4:57729910-57729932 GCCCCATGGGGACGCAGCTAAGG + Intergenic
974484766 4:62492036-62492058 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
974781724 4:66561629-66561651 GCCCCGCGGGGAGGCAGCGAAGG + Intergenic
974839323 4:67282961-67282983 GCCCCATGGGGAGGCAGCTAAGG + Intergenic
975755891 4:77570884-77570906 GCCCCATGGGAAGGCAGCTAAGG - Intronic
976646850 4:87396086-87396108 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
976677810 4:87722828-87722850 GGCCCATTGGAAGGCAGAGAAGG + Intergenic
976846085 4:89490234-89490256 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
976980275 4:91218110-91218132 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
977206543 4:94170064-94170086 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
977470682 4:97438225-97438247 GCCCCATGGGGAGGCAGCTAAGG + Intronic
977750945 4:100608905-100608927 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
978080271 4:104582201-104582223 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
978463607 4:108984534-108984556 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
978768593 4:112430648-112430670 GCTCCATGGGGAGACAGGGACGG + Exonic
978999557 4:115200334-115200356 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
979290798 4:118977190-118977212 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
979424732 4:120550877-120550899 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
979609034 4:122670436-122670458 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
979688611 4:123538137-123538159 GCCCCGGGGGAAGGCAGCTAAGG - Intergenic
979822568 4:125192126-125192148 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
979825683 4:125229720-125229742 GCCCCGCGGGAAGGCAGGTAAGG + Intergenic
979991483 4:127380155-127380177 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
980043358 4:127964377-127964399 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
980051908 4:128047698-128047720 GCCCCACGGGAAGGCAGCTCAGG + Intergenic
980115229 4:128672840-128672862 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
980228000 4:130013001-130013023 GCCCCGTGGGAAGGTAGCTAAGG - Intergenic
980470208 4:133240548-133240570 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
980799779 4:137733956-137733978 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
980815575 4:137942291-137942313 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
981146701 4:141333158-141333180 GCCCCACGGGAAGGCAGCTGAGG + Intergenic
981169540 4:141605535-141605557 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
981275837 4:142897717-142897739 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
981328286 4:143477423-143477445 GGCACTTGGGAAGGCAGAGAAGG + Intergenic
982268218 4:153559795-153559817 GACCTATGGGAATGCACTGAAGG - Intronic
982728213 4:158927922-158927944 GCCCCACAGGAAGGCAGCTAAGG - Intronic
982814561 4:159869173-159869195 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
982868784 4:160550248-160550270 ACCCCACGGGAAGGCAGCTAAGG + Intergenic
983026120 4:162739761-162739783 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
983064070 4:163189855-163189877 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
983230639 4:165126077-165126099 GCCCCACAGGAAGGCAGCTAAGG + Intronic
983553035 4:169035975-169035997 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
983834224 4:172369610-172369632 GCCCCATGGGAAGGCGGCTGAGG + Intronic
984238798 4:177193336-177193358 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
984249132 4:177310338-177310360 GCCCTAGGGGAATCCAGTGAAGG + Intronic
984662269 4:182386771-182386793 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
984770587 4:183433365-183433387 GCCCCGAGGGAAGGCAGCCAAGG - Intergenic
985114098 4:186574198-186574220 GCACCAGGGGCAGGCAGGGACGG - Intergenic
985195092 4:187420762-187420784 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
985206068 4:187538442-187538464 GCCCCATGGGTAGGCGGTGGAGG + Intergenic
985366423 4:189236528-189236550 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
985781760 5:1875381-1875403 GCCCCAAGGGAAGGGTGTGGGGG + Intergenic
986142785 5:5047554-5047576 GCCCCATGGAAAGGGTATGAGGG + Intergenic
986626186 5:9725538-9725560 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
986732428 5:10645203-10645225 GGCACAAGGGGAGGCAGTGAGGG + Intronic
986912364 5:12574084-12574106 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
986993291 5:13578687-13578709 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
987088050 5:14487748-14487770 GCGCCAGGGGGAGGCAGGGAGGG - Exonic
987146226 5:14993945-14993967 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
987315315 5:16718172-16718194 GCTCCACGGGAAGGCAGCTAAGG - Intronic
987347421 5:16991121-16991143 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
987383988 5:17311912-17311934 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
987876970 5:23691345-23691367 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
987990229 5:25200163-25200185 GTCCCACGGGAAGGCAGCTAAGG + Intergenic
988086965 5:26485419-26485441 GCCCCCCGGGAAGGCAGCTAAGG + Intergenic
988155030 5:27439590-27439612 GCCCAGTGGGAAGGCAGCCAAGG + Intergenic
988177290 5:27743682-27743704 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
988279533 5:29127762-29127784 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
988662342 5:33285548-33285570 GCCCAATGGGAAGGTCGTGAGGG + Intergenic
988883613 5:35531847-35531869 GCCCCGTGGGCAGGCAGTTAAGG - Intergenic
988912769 5:35861464-35861486 GCCTCACAGGAAGGCTGTGATGG + Intronic
988915876 5:35893007-35893029 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
988943817 5:36174109-36174131 GCTCCATGGAAAGGTAGTGATGG - Intronic
989956868 5:50369659-50369681 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
990461543 5:56035710-56035732 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
990486125 5:56260815-56260837 GCCCCATGGGAAGCCAGCAGTGG + Intergenic
990490088 5:56295545-56295567 GCCTCGTGGGAAGGCAGCTAAGG - Intergenic
990561797 5:56990936-56990958 ACCATAGGGGAAGGCAGTGAAGG - Intergenic
990823612 5:59872075-59872097 GGTCAATGGGAAGGAAGTGAAGG + Intronic
991567544 5:68020542-68020564 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
991587394 5:68215218-68215240 GCCCACTCGGAAGGCAGTGCTGG + Intergenic
993031892 5:82714910-82714932 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
993320913 5:86466821-86466843 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
993770310 5:91917497-91917519 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
994079934 5:95697312-95697334 GCCACATGGTAAGGAACTGAGGG - Intronic
994229986 5:97301369-97301391 GCCTCACGGGAAGGCAGCTAAGG - Intergenic
994254775 5:97580134-97580156 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
994507134 5:100656983-100657005 GCCCCTCGGGAAGGCAGCTAAGG - Intergenic
994570317 5:101506248-101506270 GCCCCATGGGGAGGTAGTTGAGG - Intergenic
994605581 5:101962585-101962607 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
994769769 5:103966466-103966488 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
994935298 5:106246431-106246453 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
995032341 5:107494464-107494486 GCCCCACGGGAAGGCAGCTAAGG - Intronic
995388324 5:111612305-111612327 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
995656525 5:114432901-114432923 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
996245266 5:121255932-121255954 GCCCAATGGCAAGGTACTGATGG + Intergenic
996435713 5:123430770-123430792 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
996586005 5:125088880-125088902 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
996815585 5:127569633-127569655 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
997370942 5:133359513-133359535 GGCCCTTGGCAGGGCAGTGATGG + Intronic
997760580 5:136444434-136444456 GCCCAATGGGAAGGCAGCTAAGG - Intergenic
998160276 5:139809203-139809225 GCTGCTTGGGCAGGCAGTGAGGG + Intronic
999137769 5:149334239-149334261 ACCCCATGGAAAGGAAGTGTAGG - Intronic
999350139 5:150862169-150862191 GCCACATGGCAAGGAACTGAGGG - Intronic
999384190 5:151142751-151142773 GCCGAAGGGGAAGACAGTGAAGG + Intronic
999855262 5:155586892-155586914 GCTCCGTGGGAAGGCAGCTAAGG + Intergenic
1000044282 5:157508862-157508884 GCCCCTTGGGAACCAAGTGAAGG + Intronic
1000329167 5:160194036-160194058 GCCCCATGGGAAGGCAGCTAAGG + Intronic
1000547631 5:162622064-162622086 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1000891797 5:166810335-166810357 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1000975019 5:167755161-167755183 TCTCCATGGGAAGGTTGTGATGG + Intronic
1002004613 5:176222164-176222186 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1002135305 5:177104039-177104061 GGCCCATGGGAGGGGACTGAAGG - Intergenic
1002221766 5:177688456-177688478 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002758041 6:179814-179836 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1002776053 6:328321-328343 GGGTTATGGGAAGGCAGTGAGGG - Intronic
1002817719 6:694803-694825 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003060745 6:2860361-2860383 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003070245 6:2939851-2939873 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003184156 6:3816095-3816117 GCCCCATGGGCAGAAAGTGGAGG - Intergenic
1003508818 6:6762620-6762642 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1003578050 6:7315396-7315418 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1003589614 6:7425960-7425982 GCCTCGCGGGGAGGCAGTGAAGG - Intergenic
1003591625 6:7441426-7441448 GCCCCATGGGGAAGCAGCTAAGG - Intergenic
1003671561 6:8164554-8164576 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003717644 6:8665918-8665940 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1003717723 6:8666190-8666212 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1003736917 6:8887387-8887409 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003770133 6:9290579-9290601 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1003836199 6:10074849-10074871 GCCCCGCGGGGAGGCAGTTAAGG + Intronic
1003845750 6:10171945-10171967 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1003862813 6:10337632-10337654 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1003908152 6:10720810-10720832 GCCCCGTCGGAAGGCAGCTAAGG - Intergenic
1004036988 6:11933302-11933324 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1004224415 6:13772710-13772732 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1004248465 6:14002605-14002627 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1004338207 6:14783747-14783769 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
1004665507 6:17745446-17745468 GCCCTGTGAGAAGGCAGTTAAGG + Intergenic
1004861369 6:19807150-19807172 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1004906225 6:20239241-20239263 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1004912653 6:20301473-20301495 GCCCCACGGTAAGGCAGCTAAGG - Intergenic
1005042254 6:21610043-21610065 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1005059307 6:21761379-21761401 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1005332858 6:24766075-24766097 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1005561452 6:27045463-27045485 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1005600849 6:27424967-27424989 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1005749905 6:28872732-28872754 GCCCCGTGGGAAGGCAGCCAAGG + Intergenic
1005759826 6:28958065-28958087 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1005976985 6:30807581-30807603 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1005978215 6:30816437-30816459 GCCCCGTGCGAAGGCAGCTAAGG + Intergenic
1005997572 6:30940722-30940744 GCCCCAGTGGAGGGAAGTGAGGG - Intergenic
1006005792 6:31000686-31000708 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1006008326 6:31020941-31020963 GCCCCATGGGAAGACAGCTAAGG - Intronic
1006033656 6:31195682-31195704 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1006034325 6:31199815-31199837 GCACCATGGGAATGCAGGCAAGG + Intronic
1006166883 6:32070458-32070480 GCCCCAGAGGGAGGCAGTCAAGG - Intronic
1006227047 6:32548063-32548085 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1006352664 6:33532611-33532633 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1006621858 6:35370872-35370894 GCCCCATGGTGGGGCAGTTAAGG + Intronic
1007262139 6:40571426-40571448 CCACCATGGGAAAGCAGTGTTGG + Intronic
1007738748 6:43998277-43998299 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1008005570 6:46405906-46405928 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1008038809 6:46774820-46774842 GCCCCTCGGGAAGGCAGCCAAGG - Intergenic
1008230909 6:48984122-48984144 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1008284323 6:49629688-49629710 GCCCCACGGGAAGGCAGCTAAGG + Intronic
1008545970 6:52583679-52583701 GCCCCCAGGGCAGGCAATGAGGG + Intergenic
1008771018 6:54979457-54979479 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1009407087 6:63326593-63326615 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
1009470293 6:64023955-64023977 GCCCCGCGGGAAGGCAGCCAAGG - Intronic
1009471426 6:64031335-64031357 GCCCCATGGGAAGGCAGCTAAGG - Intronic
1009664311 6:66655548-66655570 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1009833581 6:68969911-68969933 GCCACATGGGCAGCCATTGAAGG - Intronic
1010199290 6:73269013-73269035 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1010235626 6:73572675-73572697 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1010617407 6:78030024-78030046 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1011143712 6:84189589-84189611 GCCCTGTGGGAAGGCAGCTAAGG - Intronic
1011246544 6:85326190-85326212 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1011338340 6:86284958-86284980 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1011620082 6:89234628-89234650 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1011807778 6:91092137-91092159 GAGCCAGGGGAAGGAAGTGATGG + Intergenic
1011870067 6:91882033-91882055 GCCCCCTGGGAAGGCAGCTAAGG + Intergenic
1013025697 6:106269545-106269567 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1013080249 6:106805977-106805999 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1013081463 6:106816901-106816923 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1013143545 6:107364384-107364406 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1013410759 6:109881282-109881304 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1013474826 6:110497535-110497557 GGCCCATGGCCAGGCTGTGAAGG + Intergenic
1013694790 6:112689505-112689527 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1013960101 6:115889279-115889301 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1014055909 6:117014975-117014997 GCCCCTTGGGAAGGCAGCTAAGG - Intergenic
1014240765 6:119015545-119015567 GCCCCGTGGGAAGGCAGCTAAGG - Intronic
1014280826 6:119441220-119441242 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1014499265 6:122165265-122165287 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1014718582 6:124892194-124892216 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1014788492 6:125644673-125644695 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1014921051 6:127214729-127214751 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1015600368 6:134904952-134904974 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1016067346 6:139698054-139698076 GTCCCAGGGGAAGGCAGCTAAGG + Intergenic
1016069869 6:139726487-139726509 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1016092810 6:139999723-139999745 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1016217221 6:141618433-141618455 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1017281963 6:152635915-152635937 GCCCCTTGGGAAGGCAGGCTGGG - Intronic
1017299005 6:152834565-152834587 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1017325109 6:153133843-153133865 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1017537394 6:155363290-155363312 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1017581196 6:155866894-155866916 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1017779570 6:157705548-157705570 GCCCCCTAGAAAGGCAGAGAAGG + Intronic
1017994566 6:159520994-159521016 TCCCAGTGGGAAGGGAGTGACGG - Intergenic
1018030382 6:159836902-159836924 GCCCCTTGGGAGGGCTGGGAGGG + Intergenic
1018422415 6:163650843-163650865 GCCCCATGGTAAGGCAGTGGTGG - Intergenic
1018441991 6:163821966-163821988 GGAACATGGGAAGGCAGAGATGG + Intergenic
1018446367 6:163862480-163862502 GCCACATGGGAAGACAGTTGAGG + Intergenic
1018495686 6:164343833-164343855 GCCCCACAGAAAGGCAGAGAAGG + Intergenic
1018624623 6:165765425-165765447 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1018662223 6:166098715-166098737 GCAGCCGGGGAAGGCAGTGAGGG + Intergenic
1019000242 6:168743924-168743946 CCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1019327763 7:446563-446585 GGCCCATGGTGAGGCAGGGAGGG + Intergenic
1019754297 7:2757412-2757434 GCCACGTGGCAAGGAAGTGAGGG + Intronic
1019965731 7:4497069-4497091 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1021324146 7:19245705-19245727 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1021567400 7:22028861-22028883 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
1021567875 7:22032506-22032528 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1021912335 7:25398846-25398868 GCCCTTGGGGTAGGCAGTGAGGG - Intergenic
1022109871 7:27222129-27222151 CCCCCTTGGGAAGGCACTGGTGG - Intergenic
1022750455 7:33219195-33219217 GCCCCACGGGAAGGCAGCTAAGG - Intronic
1022776748 7:33534709-33534731 CCTCCATGGGCAGTCAGTGATGG + Intronic
1022841107 7:34164605-34164627 GCCCCATGAAAGGGCATTGAGGG + Intergenic
1023127957 7:36973959-36973981 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1024224256 7:47313719-47313741 GCGCCATGGGAGTGCATTGAGGG - Intronic
1024269099 7:47628698-47628720 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1024335615 7:48203052-48203074 GCCCCACGGGAAGGCAGCTAAGG + Intronic
1024443862 7:49453869-49453891 GCCCCTCGGGAAGGCAGCTAAGG - Intergenic
1024465922 7:49711474-49711496 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1024691300 7:51806048-51806070 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1024741789 7:52362828-52362850 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1024834068 7:53495242-53495264 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1026187069 7:68090553-68090575 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1026202972 7:68231254-68231276 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1026512362 7:71037815-71037837 GCCTCACGGGAAGGCAGCTAAGG - Intergenic
1026596537 7:71738218-71738240 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1027579690 7:79977742-79977764 GCCCCACAGGAAGGCAGCTAAGG + Intergenic
1027665912 7:81042929-81042951 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1027667512 7:81057622-81057644 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1027868119 7:83673539-83673561 GCCCCGAGGGAAGGCAGCTAAGG - Intergenic
1028142520 7:87288945-87288967 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
1028303281 7:89228910-89228932 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1028511199 7:91627532-91627554 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1028558025 7:92143509-92143531 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1028740841 7:94273303-94273325 GCCAGATGGGAAAGCAATGATGG - Intergenic
1029037939 7:97541431-97541453 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1029175911 7:98664337-98664359 GCTCCATTGGAAGGCACTGGCGG - Intergenic
1029271871 7:99381857-99381879 GCCCCTGGGCAGGGCAGTGACGG + Intronic
1029567529 7:101348796-101348818 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1029666270 7:101997065-101997087 GCCCCATGGGCAGGCCCTGATGG - Intronic
1029832354 7:103275064-103275086 GCCCCGTGGGAAGGCAGCCAAGG + Intergenic
1029988180 7:104940374-104940396 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1030215713 7:107042501-107042523 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1030367003 7:108657398-108657420 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1030599959 7:111582082-111582104 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1030733501 7:113017564-113017586 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1030780435 7:113593540-113593562 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1031253118 7:119413492-119413514 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1031292241 7:119951650-119951672 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1031409228 7:121421950-121421972 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
1031850369 7:126855794-126855816 TCTCCATGGGAAGGAAGTGTGGG - Intronic
1032561583 7:132898746-132898768 GCCCCACGGGAAGGCAGCTAAGG + Intronic
1033065094 7:138146342-138146364 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1033138472 7:138804094-138804116 GTTCTAGGGGAAGGCAGTGAAGG - Exonic
1033654541 7:143363575-143363597 GCCCCATGGGGAGGAGATGAAGG + Intergenic
1033664083 7:143424536-143424558 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1033758601 7:144418108-144418130 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
1034091067 7:148364029-148364051 GCCCCATGGGAAGGCAGCCAAGG - Intronic
1034097934 7:148426629-148426651 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1034167737 7:149038838-149038860 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1034632126 7:152539027-152539049 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1034656020 7:152730415-152730437 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1035257858 7:157643512-157643534 GCTGCAGGGGAAGGCCGTGATGG + Intronic
1035325434 7:158062792-158062814 GCCCCATGGGGAGGCAGCTGAGG - Intronic
1036099301 8:5759966-5759988 GCATCAGGGGAAGGAAGTGATGG - Intergenic
1036441011 8:8781531-8781553 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1036822137 8:11949890-11949912 ACCCAATGGGCAGACAGTGATGG + Intergenic
1036901593 8:12673629-12673651 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
1036914993 8:12796484-12796506 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1037241571 8:16784127-16784149 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1037263824 8:17036957-17036979 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1037425588 8:18751182-18751204 GCCCTGTGGGAAGGCAGCTAAGG + Intronic
1037516268 8:19635127-19635149 GGCCCAGGGCACGGCAGTGAAGG - Intronic
1037560164 8:20066194-20066216 GCCCCATGTGAAAGGAGTGATGG - Intergenic
1037810996 8:22086775-22086797 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1037983544 8:23272337-23272359 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1038174089 8:25164717-25164739 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1038452792 8:27650670-27650692 ACCCAGTGGGAATGCAGTGATGG - Intronic
1038847589 8:31244289-31244311 GCCCCATGGGGAGACAGCTAAGG + Intergenic
1038870720 8:31490087-31490109 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1039061325 8:33574124-33574146 GCCCTGTGGGAAGGCAGCCAAGG - Intergenic
1039433727 8:37545516-37545538 GCTCCCTGGGAAGGAAGCGAGGG - Intergenic
1039587625 8:38720018-38720040 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1039637320 8:39180335-39180357 GCCCCATGGGAAGGCAGCTAAGG - Intronic
1040323967 8:46331910-46331932 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
1040622215 8:49103150-49103172 GCCCCACGGGGAGGCAGCTAAGG + Intergenic
1040954902 8:52969987-52970009 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1040965660 8:53078220-53078242 GCCCCAGGGGGAAGCAGGGAAGG - Intergenic
1041034637 8:53776038-53776060 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1041190457 8:55348373-55348395 ACCCCTTGAGAAGGCAGGGATGG - Intronic
1041874360 8:62670640-62670662 TCCCCTTGGGAAGGCAGTTCAGG + Intronic
1041918949 8:63162210-63162232 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1043073327 8:75665604-75665626 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1043129916 8:76447753-76447775 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1043346479 8:79303715-79303737 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1043435344 8:80232029-80232051 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1043709902 8:83403163-83403185 GCCCCGTGGGAAGGCAGCCAAGG - Intergenic
1044075840 8:87821055-87821077 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1044088501 8:87971336-87971358 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1044404901 8:91816541-91816563 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1044457501 8:92404906-92404928 GCCCCATGAGAAAGCAGTGAGGG - Intergenic
1044788702 8:95823859-95823881 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1045131924 8:99163539-99163561 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1045232308 8:100316914-100316936 GCCCCGCGGGAAGGCAGCTAAGG + Intronic
1045467742 8:102485652-102485674 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1045722051 8:105123969-105123991 ACCCCATAGAAAGGCACTGAAGG - Intronic
1046208871 8:111040977-111040999 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1046288925 8:112132912-112132934 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1046445357 8:114311571-114311593 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1046676673 8:117116184-117116206 GCCTTATAGGTAGGCAGTGATGG + Intronic
1047124758 8:121948259-121948281 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1047279755 8:123434823-123434845 GACCCATTGGGAGGCAGTGGTGG + Intronic
1048655402 8:136530593-136530615 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1048789195 8:138084356-138084378 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1048993000 8:139772333-139772355 ACCTCATGGGAACCCAGTGAGGG + Intronic
1049087617 8:140490654-140490676 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1049102787 8:140591023-140591045 GGCCCATGGGAAGGCTGGGTCGG + Intronic
1049576596 8:143392605-143392627 GCCCCAGGCCAAGCCAGTGAGGG - Intergenic
1049857943 8:144875347-144875369 GCCCCATGGGGAGGCAGCTAAGG - Intergenic
1050526792 9:6553407-6553429 GCCCCATGGGGCCGCACTGACGG + Exonic
1051305068 9:15700181-15700203 GCCCCACGGGAAGGCAGCTAAGG + Intronic
1051369741 9:16348237-16348259 GACCAATGGGCTGGCAGTGACGG - Intergenic
1051439878 9:17072824-17072846 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1051892714 9:21959471-21959493 GCCCCGCGGGAAGGCAGCTAAGG - Intronic
1052750486 9:32484751-32484773 GGGCCAGGGGAAGACAGTGAAGG - Intronic
1052985329 9:34482904-34482926 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1053446851 9:38159268-38159290 GCACCATAGGAAGGCTGGGAGGG + Intergenic
1053547896 9:39042497-39042519 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1053812018 9:41862538-41862560 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1054618577 9:67324901-67324923 GCCCTGTGGGAAGGCAGCTAAGG - Intergenic
1054722470 9:68617244-68617266 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1055651392 9:78410217-78410239 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1055738974 9:79364849-79364871 GACCCACTGGAAGGCAGGGAAGG - Intergenic
1055814145 9:80185436-80185458 GTCCCATGGGGAGGCAGCTAAGG + Intergenic
1056080943 9:83093437-83093459 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1056243283 9:84669924-84669946 GCCCCAGGGGGAGACAGTGAGGG - Intronic
1056305784 9:85289266-85289288 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1056743766 9:89282645-89282667 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1056765336 9:89441569-89441591 AGACCATGGGAAGGAAGTGAGGG + Intronic
1056771376 9:89480558-89480580 GCCCCGTGGGAAGGCAGTCAAGG + Intronic
1056791404 9:89627621-89627643 GCCCCCAGGGAAGGCAGAGCAGG - Intergenic
1057333716 9:94140417-94140439 GCCCTCTGGGAAGGCAGAGAAGG + Intergenic
1057491981 9:95527547-95527569 GCTCCATGTGAAGACAGAGATGG - Intergenic
1057543842 9:96001859-96001881 GCCCCGTGGGAAGGCAGCCAAGG + Intronic
1057628614 9:96701028-96701050 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1057726925 9:97574396-97574418 GCCCCGTGGGGAGGCAGCTAAGG - Intronic
1058096145 9:100862483-100862505 ACCTCCTGGGAAGGCAGTGGAGG - Intergenic
1058174848 9:101724255-101724277 GCCCCACAGGAAGGCAGCTAAGG + Intronic
1058365200 9:104200815-104200837 GCCCCATGGGGAGGCAGCTGAGG - Intergenic
1058698816 9:107584292-107584314 GGACAATGAGAAGGCAGTGAAGG - Intergenic
1058699011 9:107585729-107585751 GGACAATGAGAAGGCAGTGAAGG + Intergenic
1058786516 9:108393734-108393756 GCCCCACAGGAAGGCAGCTAAGG - Intergenic
1059236257 9:112763006-112763028 GCCCCATGGGTGGGCAGAGGAGG + Intronic
1059810641 9:117852246-117852268 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1059991546 9:119870422-119870444 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1060091362 9:120746565-120746587 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1060594214 9:124838874-124838896 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1060814484 9:126627447-126627469 TCCCCAAGGGAAAGCAGAGAAGG + Intronic
1061087222 9:128406104-128406126 GCCCCACAGCCAGGCAGTGAGGG + Intergenic
1061130300 9:128704409-128704431 GCCACATGAGAAGGCAGCCAGGG - Intronic
1061181985 9:129029725-129029747 GCCCCAAGGGAAGGCATTTGGGG - Intergenic
1061185266 9:129049287-129049309 GGCCCATGGTCAGGCAGTGGAGG + Intronic
1061378262 9:130238931-130238953 GCAGCATGGAAAGGCAGTGTGGG + Intergenic
1061595814 9:131628508-131628530 CCTGCATGGGAAGGCAGGGAGGG - Intronic
1062146194 9:134991172-134991194 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1062689500 9:137834066-137834088 GCCCCATGGGGACGCCGTCAAGG + Intronic
1203454990 Un_GL000219v1:158587-158609 TCCCCATGGGACCTCAGTGAAGG - Intergenic
1203460420 Un_GL000220v1:31169-31191 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1185556770 X:1027483-1027505 GTCCCACGGGAAGGCTGTTATGG + Intergenic
1186152576 X:6690647-6690669 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1186295636 X:8145113-8145135 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1186662888 X:11687267-11687289 ATCCCTTGGGAAGGCAGTGATGG + Intergenic
1187005826 X:15231871-15231893 GCCCCGAGGGAAGGCAGCTAAGG + Intergenic
1187139069 X:16575673-16575695 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1187215346 X:17270570-17270592 GCCTCTGGGGAAGGCAATGAGGG - Intergenic
1187304626 X:18084023-18084045 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1187448637 X:19378280-19378302 GCCCCATGGAAGGTCAGTGCTGG + Intronic
1187557557 X:20366990-20367012 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1188189546 X:27157224-27157246 GCCCCATGGGAAGGCAGCTAAGG - Intergenic
1188242569 X:27809314-27809336 GCCCCACGGGAAGGAAGCTAAGG - Intronic
1189209843 X:39275794-39275816 GCCCTATGGGAAGGCAGCTAAGG - Intergenic
1192186769 X:68952334-68952356 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1192869643 X:75173738-75173760 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1192870551 X:75179658-75179680 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1193708958 X:84856788-84856810 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1193725305 X:85031688-85031710 GCAGCATGTGAAGGCACTGAGGG + Intronic
1193804022 X:85972498-85972520 GCCCCGTGGGAAGGCAGCTAAGG + Intronic
1194025581 X:88746511-88746533 GCCCCTTGGGGAGGCAGCTAAGG + Intergenic
1194166363 X:90521555-90521577 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1194384398 X:93235951-93235973 GCTCCATGGGGAGGCAGCTAAGG - Intergenic
1194468599 X:94263845-94263867 GACTCAGGGGAAGGCAGTGAGGG + Intergenic
1194650806 X:96512392-96512414 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1195256318 X:103094290-103094312 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1195259354 X:103117251-103117273 GCCCCATGGGAAGGCAGCTAAGG + Intergenic
1196582711 X:117394901-117394923 GCCCCACGGGAAGGCAGCTAAGG - Intergenic
1196705895 X:118717077-118717099 GCCCCGTGGGAAGGCAGCTAAGG + Intergenic
1196714630 X:118799176-118799198 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1196728914 X:118922124-118922146 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1196762331 X:119211020-119211042 GCCCCACGGGAAGGCAGCTAAGG + Intergenic
1196775217 X:119332094-119332116 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1196814710 X:119655580-119655602 GTCCCATGGAAGGGCAGAGAGGG + Intronic
1196827255 X:119750962-119750984 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1196845078 X:119890811-119890833 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1197000272 X:121431669-121431691 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1198060933 X:133044597-133044619 GCCCCACGGGGAGGCAGCTAAGG - Intronic
1198300003 X:135325674-135325696 GCCCTGTGGGAAGGCAGCTAAGG - Intronic
1198694464 X:139321022-139321044 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1198872295 X:141188679-141188701 GCCCTGTGGGAAGGCAGCTAAGG + Intergenic
1199009925 X:142745864-142745886 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1199134161 X:144231393-144231415 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1199175554 X:144783838-144783860 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1199356229 X:146867023-146867045 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1199628121 X:149758745-149758767 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1199691254 X:150310600-150310622 ACCCGAGGGGAATGCAGTGAGGG + Intergenic
1199719098 X:150529372-150529394 GCCCCCTGGGGAAGCAGTGCAGG + Intergenic
1199831265 X:151551328-151551350 GCCCCACTGGAAGGCAGCTAAGG + Intergenic
1200064604 X:153498435-153498457 GAACCATGGGATGGCAGTCAAGG - Intronic
1200423545 Y:2998516-2998538 GCCCCGCGGGAAGGCAGCTAAGG + Intergenic
1200512632 Y:4099336-4099358 GCCCCGCGGGAAGGCAGCTAAGG - Intergenic
1200824279 Y:7622357-7622379 GCCCCATGGGAAGGCAGGTAAGG + Intergenic
1201429196 Y:13888039-13888061 GCCCCACGGGGAGGCAGCTAAGG - Intergenic
1201479952 Y:14428310-14428332 GCCCAGTGGGAAGGCAGCCAAGG - Intergenic
1201487084 Y:14505870-14505892 GCCCCGTGGGAAGGCAGCTAAGG - Intergenic
1201495678 Y:14589924-14589946 GCCGCATGGGAAGGCAGCTGAGG + Intronic
1201496919 Y:14598337-14598359 GCCCCGTGGGAAGGCAGCTGAGG + Intronic
1201556328 Y:15267474-15267496 GCCCCATGGGGAGGCAGCTATGG - Intergenic
1201771964 Y:17624106-17624128 GTCCCATGTGGATGCAGTGATGG + Intergenic
1201829591 Y:18281880-18281902 GTCCCATGTGGATGCAGTGATGG - Intergenic
1201982608 Y:19923857-19923879 GCCCCTCGGGAAGGCAGCTAAGG + Intergenic
1202235774 Y:22708730-22708752 GCCCCATGGGAAGGCAGGTAAGG - Intergenic
1202271477 Y:23078480-23078502 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1202294549 Y:23342202-23342224 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1202307389 Y:23487438-23487460 GCCCCATGGGAAGGCAGGTAAGG + Intergenic
1202424472 Y:24712224-24712246 GCCCCGTGGGGAGGCAGCTAAGG + Intergenic
1202446317 Y:24957861-24957883 GCCCCGTGGGGAGGCAGCTAAGG - Intergenic
1202498106 Y:25460830-25460852 GACCCAGGGGAAGGCAGGAAGGG + Intergenic
1202563416 Y:26183148-26183170 GCCCCATGGGAAGGCAGGTAAGG - Intergenic