ID: 901817375

View in Genome Browser
Species Human (GRCh38)
Location 1:11802499-11802521
Sequence AAGTGCTAATGTAATTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901817375 Original CRISPR AAGTGCTAATGTAATTCAGT TGG Intronic
901817375 1:11802499-11802521 AAGTGCTAATGTAATTCAGTTGG + Intronic
903098482 1:21004253-21004275 AAGTGATAATGTAATACACACGG + Intronic
904932995 1:34105301-34105323 AGGTGCTACTGGCATTCAGTGGG - Intronic
905040358 1:34951720-34951742 AAGTCCTACTGCAATTTAGTGGG - Intergenic
905088052 1:35401870-35401892 AGTTGCCAATGTAATTCAATGGG - Intronic
905982038 1:42237879-42237901 AGGTACCAATGTAATTCAGTAGG - Intronic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906173596 1:43749080-43749102 AAGTAATAACATAATTCAGTGGG + Intronic
906388154 1:45389983-45390005 AAGTTTTAATGTTATTCTGTAGG - Intronic
906419875 1:45656614-45656636 AAGTACAAAGGTAATTCAATGGG - Intronic
907462559 1:54613714-54613736 GAGTGCTAATTTTACTCAGTAGG - Intronic
907655647 1:56339746-56339768 AGGTGCTAAGGTAATTCAATGGG - Intergenic
907694974 1:56715927-56715949 AAGGGCTTATGTGATTAAGTTGG + Intergenic
908819675 1:68071733-68071755 AAGTGTCAATGTAATTGAGCTGG - Intergenic
908855668 1:68424359-68424381 AAGTGCTAAGAAAATTCAATGGG - Intergenic
909256067 1:73424032-73424054 AGGTGCAAAGGTAATGCAGTGGG + Intergenic
910365837 1:86464456-86464478 AAGCACAACTGTAATTCAGTAGG + Intergenic
911259310 1:95667378-95667400 AGGTGCCAAAGTGATTCAGTGGG + Intergenic
912493207 1:110073918-110073940 AAATGCTGTTATAATTCAGTTGG - Intronic
913214399 1:116608384-116608406 ATGTGCTAATGTGGTTTAGTTGG - Intronic
914481039 1:148065889-148065911 AAGTGTTACTGACATTCAGTTGG + Intergenic
916830849 1:168489424-168489446 AAGTCCTCTTGTAATTCTGTAGG + Intergenic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
918314349 1:183310632-183310654 AAGTGCTACTGTCATTTAGTTGG + Intronic
918388305 1:184033328-184033350 AAGTGGTAGTGTACTTCAGTGGG - Intronic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
918923386 1:190745862-190745884 AAGTGCTTAAATAATTAAGTAGG + Intergenic
919295990 1:195700730-195700752 AACTGTCAATGTAATTCATTGGG - Intergenic
919987385 1:202685356-202685378 CATTGCTAATGGAATTCTGTTGG - Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
920917928 1:210272986-210273008 CTGTGCTAATGGAATTCAGAAGG - Intergenic
921107640 1:211998439-211998461 AGATGCTAAAGTAATTCAATGGG + Intronic
921388700 1:214597621-214597643 AGACGCTAAGGTAATTCAGTGGG + Intergenic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
923632181 1:235658420-235658442 AACTGCTAATGCTTTTCAGTTGG + Intergenic
924197760 1:241625911-241625933 AGATGCTACTGTCATTCAGTGGG - Intronic
1063263134 10:4413290-4413312 AAGAGCTATTATAATTCATTGGG + Intergenic
1063516241 10:6698680-6698702 AAATCCTAATGCAATACAGTAGG - Intergenic
1063520668 10:6737915-6737937 AAGGGCTAATGTAATACAACTGG - Intergenic
1063594896 10:7425506-7425528 CAGTCCTAATGGAATTCACTGGG - Intergenic
1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG + Intronic
1064607227 10:17056146-17056168 AAATGCAAAAGCAATTCAGTGGG + Intronic
1065028462 10:21561699-21561721 AAGTGCCAGTATCATTCAGTGGG - Intronic
1065194638 10:23251425-23251447 AAGCTCTACTGTGATTCAGTTGG - Intergenic
1067320374 10:45214309-45214331 AAGTGCAAAGGCAATTCAGTGGG + Intergenic
1067381851 10:45781565-45781587 AGGTGCTAAGATATTTCAGTGGG + Intronic
1067677435 10:48395856-48395878 AGATGCAAAAGTAATTCAGTGGG + Intronic
1067852994 10:49767539-49767561 AAGTGCAAAAGCAATTCAATGGG - Intergenic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068568513 10:58602960-58602982 AAGTGCTAAAGTAAATCAGCAGG - Intronic
1068931879 10:62598801-62598823 AGGTGCTAAGGTAATTAAATGGG + Intronic
1069244484 10:66186510-66186532 AATTTCTAATTTAATTCAGTTGG - Intronic
1069284878 10:66701130-66701152 AAGTTCAAAGGCAATTCAGTGGG - Intronic
1070763436 10:79040959-79040981 AAGTGATAAGGTTATTCAGTGGG + Intergenic
1070905436 10:80068413-80068435 AAGGGGTTATATAATTCAGTTGG - Intergenic
1072356267 10:94614673-94614695 GAGTGCTATTGTAATCCAGTGGG + Intergenic
1074570237 10:114617673-114617695 AAATGTTAATGAAAGTCAGTTGG - Intronic
1076940242 10:133600558-133600580 AAGTGCTAATGGATTCAAGTTGG - Intergenic
1077437912 11:2552347-2552369 AGGTGCCAAAGTAATTCAATGGG - Intronic
1078189473 11:9080168-9080190 AAGTGCTAAGGTAATCCATTGGG + Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085462892 11:76705827-76705849 AAATGATAAAATAATTCAGTGGG - Intergenic
1085900635 11:80695873-80695895 AAGAGCATATGTAATGCAGTTGG + Intergenic
1086398067 11:86436795-86436817 AATTACTAAGGTAATTCATTGGG - Intergenic
1086570127 11:88273655-88273677 AAGTGCAATGGTAATTCAGTGGG + Intergenic
1088132433 11:106509677-106509699 AAATGCTATTCTAATTCTGTTGG + Intergenic
1088442145 11:109882605-109882627 AAGTGTTAATGAATATCAGTAGG + Intergenic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1092594943 12:9991971-9991993 AAATGCTGATGTTACTCAGTGGG - Intronic
1092732704 12:11549152-11549174 ATGTGGTAAAATAATTCAGTGGG - Intergenic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1098133991 12:67382171-67382193 AAGTGTTAATGTATGACAGTGGG + Intergenic
1098392848 12:69987393-69987415 AAGAGATAATCTAATTCAGCTGG - Intergenic
1099087724 12:78266239-78266261 AGGTGCAAACGTAATTCAGCGGG - Intergenic
1100083693 12:90881534-90881556 AATAGCAAATGTAATTCATTAGG - Intergenic
1100601140 12:96112358-96112380 AAGTGCTACTGGTATCCAGTGGG + Intergenic
1100681239 12:96924136-96924158 AGGCATTAATGTAATTCAGTGGG - Intronic
1101342556 12:103856203-103856225 GAGTGCTACTGTTATTTAGTGGG - Intergenic
1103260877 12:119587438-119587460 AAGTGGTAATGGAAATCAGAGGG - Intergenic
1105218131 13:18301894-18301916 ATGTGCTAATGTGGTTTAGTTGG - Intergenic
1106214617 13:27684962-27684984 AAGTGCAAAAGCAATTTAGTGGG + Intergenic
1107064250 13:36195556-36195578 AAATGCAAATGTAATTGTGTTGG - Intronic
1107746535 13:43516299-43516321 AAGTCATGATGTAAGTCAGTGGG + Intronic
1107891033 13:44914694-44914716 AAGTGTTAATGTAATTATTTAGG + Intergenic
1108319777 13:49277823-49277845 ATGTGCTATTGTGATTTAGTTGG - Intronic
1108487282 13:50939653-50939675 AAGTGTGAAGATAATTCAGTGGG + Intronic
1109432779 13:62257303-62257325 AAGTGCAAATGTAATTTAGAGGG - Intergenic
1110407839 13:75170378-75170400 GAGTGCTAATGGATTTCAGTAGG + Intergenic
1112759934 13:102683637-102683659 AGGTGCCAAAGTAATTCAATGGG - Intergenic
1112982727 13:105406348-105406370 GAGTGCTAATGTAATTCTACAGG - Intergenic
1114373735 14:22120056-22120078 AGGTGCCAATGCAGTTCAGTGGG - Intergenic
1114865865 14:26596175-26596197 AAGTGCTAAAGAAATGCACTAGG - Intronic
1115857527 14:37647032-37647054 AAGTGCTATTGGCATTTAGTAGG - Intronic
1116056952 14:39875860-39875882 AAGTGCAAATGTGATTCAAGGGG + Intergenic
1116388531 14:44362301-44362323 AGGTACTAGTTTAATTCAGTGGG + Intergenic
1116754806 14:48933964-48933986 AGGTGCCAAAGTAATTCAATGGG + Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1118343982 14:64921080-64921102 AAGCACCATTGTAATTCAGTGGG + Intronic
1118437386 14:65784224-65784246 AATTGCTAATGTATATCAATGGG + Intergenic
1118928899 14:70221196-70221218 AAGTGCTCATGTAAATCAATAGG + Intergenic
1120593857 14:86409279-86409301 AAGTCCTAAGGTAGTTCAGAAGG + Intergenic
1120820625 14:88908750-88908772 AAGTTATAATTTAAGTCAGTAGG + Intergenic
1121468709 14:94134996-94135018 AGGTACTAAGGTAATTCAATAGG + Intergenic
1121566374 14:94913017-94913039 AACTGATAGTATAATTCAGTTGG - Intergenic
1122376173 14:101260485-101260507 AAGTTCCAGTGTAATTCAATCGG - Intergenic
1125390939 15:39192118-39192140 ATGTGCTAATGGAAAGCAGTGGG - Intergenic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1126782123 15:52147929-52147951 AAACTATAATGTAATTCAGTAGG - Intronic
1127184956 15:56469114-56469136 AAGAGCTTATATAATTCAGAAGG - Intergenic
1127631239 15:60829249-60829271 TAGGGCTAATGGAATTCAGCAGG + Intronic
1129281819 15:74491282-74491304 CAGTGCAATTTTAATTCAGTGGG + Intergenic
1130409049 15:83629428-83629450 AGGTACTGAGGTAATTCAGTGGG + Intergenic
1131922816 15:97348835-97348857 AAGTGCTCAGATAGTTCAGTGGG - Intergenic
1132335781 15:101047547-101047569 AAGTCCTATTGAAATTCAGATGG + Intronic
1135894777 16:26389319-26389341 AAGTGCCAGTGCAATTCAGTGGG - Intergenic
1137473703 16:48787603-48787625 ATGTGCTAAGATACTTCAGTGGG - Intergenic
1139243147 16:65414725-65414747 AATTACTAATGTAATTCAAGGGG - Intergenic
1139963095 16:70729145-70729167 AAGTGCTACTGGCATTCAGGGGG + Intronic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1141061025 16:80870483-80870505 AAGTTCCAATTTAATTCAATGGG + Intergenic
1143832080 17:9660594-9660616 ACGTGCTATTGGAATCCAGTGGG - Intronic
1144337206 17:14282094-14282116 AACTGCTAATGGAAGTCAATGGG + Intergenic
1144610842 17:16713369-16713391 AAAAGATAATGTATTTCAGTAGG + Intronic
1144901901 17:18602017-18602039 AAAAGATAATGTATTTCAGTAGG - Intergenic
1144929164 17:18843929-18843951 AAAAGATAATGTATTTCAGTAGG + Intronic
1145092110 17:19994535-19994557 AAGTGCTAAGAAAATTCGGTTGG - Intergenic
1145130601 17:20344052-20344074 AAAAGATAATGTATTTCAGTAGG + Intergenic
1145922602 17:28621700-28621722 AAGTGTGCATGTAACTCAGTTGG - Intronic
1146395398 17:32461061-32461083 AAGTGCTATTGTGTTTCAATTGG - Intronic
1149081368 17:52661780-52661802 AAGTGATTTTTTAATTCAGTAGG + Intergenic
1150073984 17:62176791-62176813 AAGTGCCAAAATAATTCAATAGG + Intergenic
1150178496 17:63088923-63088945 GAGTGCTAATGTTATTCTGCAGG - Intronic
1152972878 18:181983-182005 AGGTGCTAAGACAATTCAGTGGG - Intronic
1153613949 18:6917110-6917132 AACTGCCAAGGCAATTCAGTGGG + Intergenic
1153764241 18:8360195-8360217 AAGGAGAAATGTAATTCAGTAGG + Intronic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1155504481 18:26519742-26519764 TTGTACTAATATAATTCAGTTGG + Intronic
1156320668 18:36018788-36018810 AAATGACAATGTAATACAGTTGG + Intronic
1158270221 18:55705055-55705077 AAGTGTCAATGTAGTTCAATGGG - Intergenic
1158313160 18:56180975-56180997 AACTGTTAATTTAATTCATTTGG + Intergenic
1158952548 18:62508250-62508272 AAGTGCTACAGTAGTTCAGAGGG + Intergenic
1159616949 18:70591970-70591992 AAGTTAAAATGTAATTCAGCGGG - Intergenic
1159671262 18:71223929-71223951 AAGTGCTAATGGATGTAAGTTGG - Intergenic
1163997483 19:21064666-21064688 AAGTGCAAATGTTCTTCATTAGG + Intergenic
1164517331 19:28947674-28947696 AGGTGCTATTGGAATACAGTGGG + Intergenic
1165142926 19:33713181-33713203 AAGACCTAATGTGATTCTGTGGG + Intronic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1166089623 19:40499868-40499890 AGGTGCTAATGGATGTCAGTTGG + Intronic
927907293 2:26868598-26868620 AAGTGATATTTCAATTCAGTGGG - Intronic
928075379 2:28259835-28259857 AGGTGCTAAGGTAATTTAATGGG - Intronic
928214158 2:29347366-29347388 AAGTGCTCATGGAAATGAGTTGG - Intronic
929866050 2:45718169-45718191 AAGTGCTATTGACATTTAGTGGG - Intronic
930315555 2:49792986-49793008 AAGTACTAATGTCATTCATGAGG + Intergenic
931049453 2:58394288-58394310 AAGTATTCATGTGATTCAGTTGG - Intergenic
931311497 2:61085402-61085424 ACGTACTAGTGCAATTCAGTGGG - Intronic
933152766 2:78934832-78934854 AGGTGCTACTGTCATTTAGTGGG - Intergenic
934296173 2:91744770-91744792 ATGTGCTAATGTGGTTTAGTTGG + Intergenic
935136997 2:100314776-100314798 AGATGCTAATGGAATTCAATGGG - Intronic
935206356 2:100899819-100899841 AAGTGCTAATGCAATTCAACAGG + Intronic
935531544 2:104238919-104238941 AATTGTTCATGTAATTCTGTAGG - Intergenic
935551223 2:104457662-104457684 AGGTGCAAAAGCAATTCAGTAGG - Intergenic
935609752 2:105009619-105009641 TAGTGCTAAGTTAATTCAGCAGG + Intergenic
935613490 2:105051309-105051331 AAGTGATAAAATAATTCAATGGG - Intronic
935873580 2:107479914-107479936 AAATGCTAATGTAAATCAATGGG - Intergenic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937635572 2:124151994-124152016 GCGTGTTAATGTATTTCAGTGGG - Intronic
937898001 2:126993186-126993208 ATGTGCTGCTGCAATTCAGTCGG + Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938834562 2:135087184-135087206 AGGTGCTACTGGAATTCAGGGGG - Intronic
941768396 2:169324427-169324449 TAGTGCTTATATACTTCAGTTGG + Intronic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
944192836 2:197021990-197022012 AAATGCTTATGAAATTCACTGGG + Intronic
944320218 2:198331885-198331907 AAGGGCTCATGTGATTCAATTGG + Intronic
944367395 2:198938648-198938670 AAGGGCTTAGGTAAGTCAGTGGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
945006308 2:205411100-205411122 AAGTGCTACTGGAATCTAGTAGG + Intronic
945676871 2:212865500-212865522 AAATGCTAATGTTATTCTGATGG + Intergenic
946580527 2:221123291-221123313 AAGTGATAATTTAATTCAACTGG + Intergenic
946758887 2:222973579-222973601 AAGTGCTACTGGTATCCAGTGGG - Intergenic
946920135 2:224571687-224571709 AAGTTCTAATGTGAAGCAGTGGG - Intronic
947401819 2:229738646-229738668 ATGTGCTATTGCAATTAAGTTGG + Intergenic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
1172413494 20:34743992-34744014 AAGGGCAATTTTAATTCAGTCGG - Intronic
1173552134 20:43939862-43939884 GGGTGCTTATGTGATTCAGTCGG + Intronic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1178101781 21:29277636-29277658 AAGTGCCAAAGTAAATCAATGGG + Intronic
1179555119 21:42168719-42168741 AAATGCTAAGGTAATTGAATGGG - Intergenic
1180088558 21:45521736-45521758 AGGTGCAAAAGTAATTCAATGGG + Intronic
1180111539 21:45657414-45657436 AAGTGCTAAGGCCATTCAATAGG - Intronic
949410087 3:3754016-3754038 AAGCGGTAATCTTATTCAGTAGG - Intronic
949841672 3:8326757-8326779 AAGTTCTTATGTTCTTCAGTGGG + Intergenic
951090552 3:18568424-18568446 GAGTGGTAAAATAATTCAGTAGG - Intergenic
951833135 3:26952096-26952118 AAATGGTAATGTAATACTGTGGG - Intergenic
952021903 3:29032961-29032983 AAATGCTAATGAAATTTAGTAGG - Intergenic
952861005 3:37812162-37812184 ATGTGCCAATGACATTCAGTGGG + Intronic
953273306 3:41468383-41468405 AGGTGCTAATATAATACAGTAGG + Intronic
953898941 3:46827850-46827872 AAGTGCTGAGGTAATTAATTGGG - Intergenic
954703081 3:52462329-52462351 AAGTGCTACTGGCATCCAGTGGG - Intronic
955441430 3:58959531-58959553 AAGTGCTAAAGCAATTTAATGGG - Intronic
956237041 3:67083868-67083890 GAGTTCCAATGTAATTGAGTTGG + Intergenic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
958582079 3:96039841-96039863 AAGTGCTAATCTGATTCATGAGG + Intergenic
961604738 3:128085295-128085317 AATTGCTCAAGTCATTCAGTAGG + Intronic
961930512 3:130528332-130528354 AATTGTTATTCTAATTCAGTAGG + Intergenic
962347911 3:134634468-134634490 AAGTGCAAAGACAATTCAGTTGG + Intronic
962943692 3:140148336-140148358 AATTGCTAATGACATTGAGTGGG + Intronic
962970447 3:140396132-140396154 AATTGCTAATGGCATTCACTGGG - Intronic
963600460 3:147373922-147373944 AACTGCTCATGTATTTAAGTGGG - Intergenic
963999028 3:151745786-151745808 AAGTGCTACTGTAATTCAATGGG - Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
965256314 3:166417550-166417572 AACTGCTAAGGTAATTCACTGGG + Intergenic
965739150 3:171854979-171855001 AAGGGGTTGTGTAATTCAGTTGG + Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
967012898 3:185453319-185453341 AAATGCTACTGGAAGTCAGTGGG - Intronic
967141456 3:186564828-186564850 AAGTGCTAATGTGAGGCAGCAGG + Intronic
967703092 3:192617640-192617662 AAATGCTGATCCAATTCAGTGGG + Intronic
971158812 4:24112203-24112225 TAGTGCCAATGTAAGACAGTAGG + Intergenic
971795433 4:31220793-31220815 AAGTGCTGATATTATTGAGTTGG + Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
976262816 4:83161946-83161968 AAGTACTAGTGAAAGTCAGTGGG + Intergenic
976267776 4:83201281-83201303 ATGTGGTAATTTAATTCAGGAGG + Intergenic
976443700 4:85106379-85106401 AAATGCAAATCTGATTCAGTAGG - Intergenic
976913344 4:90337173-90337195 AAGTTGAAATGTAATGCAGTGGG + Intronic
977398809 4:96505392-96505414 AATTGCTGATGTTCTTCAGTAGG + Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
979943103 4:126787831-126787853 ATGTGGTAATGGATTTCAGTTGG + Intergenic
980310498 4:131123896-131123918 AAATGCTATTGAAATGCAGTGGG - Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
983090915 4:163500917-163500939 AAGTACTATTGTATTTAAGTTGG + Intronic
984621231 4:181954976-181954998 AGGTGCTAAGGTAATTCAATGGG - Intergenic
986922055 5:12697483-12697505 ATATGCTAAGGTAATTCAATGGG + Intergenic
988272047 5:29029687-29029709 AAGTACTTATGTAATTCCGAAGG - Intergenic
988675891 5:33432759-33432781 GAGTGCTATTGATATTCAGTGGG + Intergenic
989352055 5:40497896-40497918 AAGAGCCAAAGGAATTCAGTTGG - Intergenic
989431799 5:41364148-41364170 AGGTGCTACTGGAATCCAGTGGG + Intronic
990294900 5:54391124-54391146 ATGTGCTATTATAAATCAGTGGG + Intergenic
990317162 5:54593761-54593783 AGGTGCTAAGGTAATTCCATGGG + Intergenic
990590461 5:57257522-57257544 AAATGCTAAAGAAATTCAGAGGG + Intronic
992177084 5:74160299-74160321 AAGTGCTCATATAATACATTTGG + Intergenic
992278741 5:75150830-75150852 AATTGCAAATAAAATTCAGTTGG - Intronic
994020763 5:95022782-95022804 AAGTGCTAATTTTTATCAGTTGG - Intronic
994341770 5:98638066-98638088 AAGTTCAAATATAATTGAGTTGG + Intergenic
995523124 5:113029588-113029610 AAGTGCAAATGTAATTTCATGGG - Intronic
995839089 5:116426301-116426323 AAGTGCTAATAGCATTTAGTGGG + Intergenic
995974360 5:118013724-118013746 CAGTGCTAAGATACTTCAGTGGG - Intergenic
997591564 5:135076319-135076341 AAGAGCTTATATAAGTCAGTTGG + Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
997971887 5:138410411-138410433 AGGTGCCAAGGTAGTTCAGTGGG + Intronic
1003836313 6:10075448-10075470 AATTGCTAATAAAATTCACTGGG - Intronic
1007963176 6:45979568-45979590 AGGTGCTAATCTTATGCAGTAGG - Intronic
1007977618 6:46117385-46117407 AAGTGATTCTGTAATTCAGCAGG + Intergenic
1008375372 6:50785588-50785610 GAGTGCTATTGTCATCCAGTGGG - Intergenic
1008857731 6:56112162-56112184 AAGTTCTAATGTAATTCAAAGGG + Intronic
1008885861 6:56431198-56431220 AAGTCCAAATGAAAATCAGTTGG - Intergenic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1009633225 6:66227367-66227389 AAGTACAAAAGGAATTCAGTGGG - Intergenic
1009995767 6:70893542-70893564 CAGGGCTAATTCAATTCAGTTGG + Intronic
1012501060 6:99888593-99888615 AAGTAATATTGTAATTCAGATGG + Intergenic
1012511466 6:100007153-100007175 AACTGCCAATGTAATACAATAGG + Intergenic
1014545174 6:122726833-122726855 AGGTGCTACTGTAATGTAGTGGG + Intergenic
1014732583 6:125051010-125051032 AAATGCTAACATAATTTAGTAGG - Intronic
1015185430 6:130410308-130410330 AAGGGCCAATGAAATTCAGATGG + Intronic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1016477795 6:144446888-144446910 AAGTTGTAATGTAATTCCTTTGG + Intronic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1018415416 6:163597943-163597965 AAGTACTGTTTTAATTCAGTGGG + Intergenic
1023484597 7:40672058-40672080 AGGTGCAAAAGCAATTCAGTAGG + Intronic
1023650343 7:42363171-42363193 AAGTGCTATTATAAATTAGTAGG - Intergenic
1027717186 7:81687591-81687613 AAGTTCTATTGTCATTAAGTGGG + Intergenic
1028035986 7:85982826-85982848 AGGTGCTATTGTAATTAAGAGGG + Intergenic
1030187917 7:106781263-106781285 AAGTTGCAATGTAATTGAGTAGG + Intergenic
1030350049 7:108474695-108474717 AGATGCTAAGGTAACTCAGTGGG - Intronic
1030511430 7:110487352-110487374 AAGTGCAAATGGCATTAAGTAGG + Intergenic
1030631216 7:111897862-111897884 AAGTGATCATTTAATTAAGTGGG - Intronic
1031228415 7:119072319-119072341 AAGTATTTATGTAATTCATTTGG + Intergenic
1033266743 7:139893628-139893650 TGGTGCAAATGTAATTCAATGGG - Intronic
1034854910 7:154535094-154535116 AAATGCTGAAGTAATTCAGTGGG + Intronic
1036111494 8:5907780-5907802 TAATGATAATATAATTCAGTTGG + Intergenic
1036776587 8:11617180-11617202 AAGAGCTGATGCAATTCGGTGGG + Intergenic
1038180434 8:25222350-25222372 AAATGGAAATATAATTCAGTGGG + Intronic
1038675443 8:29618609-29618631 AATTGCTAATGGATTTCAGCTGG + Intergenic
1038881753 8:31621721-31621743 AAGTGCTAAGGTAATATAATGGG + Intergenic
1038914448 8:32004916-32004938 AAGTGTTCATTTAATACAGTGGG + Intronic
1039273180 8:35905639-35905661 AACTACTGATGTAGTTCAGTTGG + Intergenic
1039341430 8:36654414-36654436 TACTGCTACTGTAATTCACTTGG + Intergenic
1040638043 8:49298720-49298742 AAGAGCTTATGTAATACAGCTGG + Intergenic
1041553697 8:59129057-59129079 AGATGCCAAGGTAATTCAGTGGG + Intergenic
1043953378 8:86334947-86334969 AAGTTCCAAAGTAATTCAATGGG + Intergenic
1044012732 8:87015038-87015060 AGGGGCTTGTGTAATTCAGTTGG + Intronic
1044181476 8:89200926-89200948 AAGTTCTTATGTAATTCACTGGG + Intergenic
1047372132 8:124264974-124264996 AGGTGCTACTGGAATCCAGTGGG - Intergenic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1050769274 9:9176560-9176582 AATTGCTAATGTAATGGTGTTGG + Intronic
1051008910 9:12385440-12385462 AATTGCTAATGTATTTTAGAGGG + Intergenic
1051530567 9:18098095-18098117 AAAGGCTAATGTAATTCAATGGG - Intergenic
1051966901 9:22839228-22839250 AGGTGCAAAGGTAATTCAGTGGG - Intergenic
1054711866 9:68518811-68518833 AAGTGCTAACATAATTTAGTTGG + Intronic
1055221428 9:73937044-73937066 AAGTGCTAATGGCATCTAGTGGG - Intergenic
1055466842 9:76574463-76574485 CAGTCCTAATGTCATTCAGCAGG - Intergenic
1055623927 9:78153034-78153056 ATGTTCTAAGGTAATTCAATGGG - Intergenic
1056535788 9:87526543-87526565 AAATCCAAATGTCATTCAGTTGG - Intronic
1057344468 9:94236462-94236484 AAGTGCTAAGGCAATCCAGTAGG + Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1060576581 9:124701172-124701194 CAATGGTAATGTAAATCAGTTGG - Intronic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1186844742 X:13519355-13519377 AAGTGCTACTGGAATCTAGTGGG + Intergenic
1188380577 X:29486770-29486792 AAGTGCTAATGAGATACACTGGG + Intronic
1188536681 X:31204187-31204209 AATTGCTACTGGAATTGAGTTGG - Intronic
1188647347 X:32586404-32586426 ATGTACTAATGCAATTGAGTGGG + Intronic
1189054335 X:37683487-37683509 TAGTGCTAATGGAAATTAGTAGG - Intronic
1190145416 X:47887089-47887111 AAGTGCCAATGTGATTCAATGGG - Intronic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1194620911 X:96170239-96170261 AAGTGCTAAAGAAATTCAGAAGG - Intergenic
1194835947 X:98682971-98682993 AAGTGGTAATGTATATCACTGGG - Intergenic
1195762532 X:108262230-108262252 AGGTGCTAATGTAAGACATTGGG + Intronic
1195791568 X:108593678-108593700 AAGTGCTAATGCAATTCATTGGG - Intronic
1196058328 X:111380435-111380457 AAATACCAATGTAATTCAATAGG - Intronic
1196732602 X:118956114-118956136 AAGTGCGATTGTGATTCACTAGG + Intergenic
1197091229 X:122539928-122539950 AACTGCCAATATAATTCACTGGG + Intergenic
1197403634 X:126025068-126025090 GAGTGCTAAGACAATTCAGTGGG - Intergenic
1198465458 X:136900967-136900989 GAGTGCTAAGGCAATTCACTGGG - Intergenic
1198682437 X:139197295-139197317 AAGAGCTACTGTACTTCATTTGG + Intronic
1198782520 X:140252846-140252868 AAATGATATTTTAATTCAGTGGG + Intergenic
1199298028 X:146181351-146181373 CAGTGCAAATGTAATTGAGGAGG + Intergenic
1199831416 X:151552206-151552228 TAGTGCTATTTTAATTCATTTGG - Intergenic
1201465237 Y:14273460-14273482 ATGTGCTACTGTCATCCAGTGGG - Intergenic