ID: 901819092

View in Genome Browser
Species Human (GRCh38)
Location 1:11814709-11814731
Sequence GAAGAGGCACAGATTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901819092_901819097 3 Left 901819092 1:11814709-11814731 CCAAGCTGAATCTGTGCCTCTTC 0: 1
1: 0
2: 2
3: 24
4: 270
Right 901819097 1:11814735-11814757 ACATAAAGTGGAAGTTGGCCAGG 0: 1
1: 0
2: 0
3: 22
4: 282
901819092_901819098 11 Left 901819092 1:11814709-11814731 CCAAGCTGAATCTGTGCCTCTTC 0: 1
1: 0
2: 2
3: 24
4: 270
Right 901819098 1:11814743-11814765 TGGAAGTTGGCCAGGCGCAGTGG 0: 2
1: 5
2: 125
3: 1005
4: 5075
901819092_901819093 -9 Left 901819092 1:11814709-11814731 CCAAGCTGAATCTGTGCCTCTTC 0: 1
1: 0
2: 2
3: 24
4: 270
Right 901819093 1:11814723-11814745 TGCCTCTTCCTAACATAAAGTGG 0: 1
1: 0
2: 2
3: 10
4: 170
901819092_901819095 -2 Left 901819092 1:11814709-11814731 CCAAGCTGAATCTGTGCCTCTTC 0: 1
1: 0
2: 2
3: 24
4: 270
Right 901819095 1:11814730-11814752 TCCTAACATAAAGTGGAAGTTGG 0: 1
1: 0
2: 2
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901819092 Original CRISPR GAAGAGGCACAGATTCAGCT TGG (reversed) Intronic
901123018 1:6910379-6910401 GCATAGGCACAGAGTCACCTGGG + Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
904858556 1:33518112-33518134 GAAGAGTCACAGAGCCAGCCAGG - Intronic
904915778 1:33969815-33969837 GAAAAGGCAGAAATTCAGCCGGG + Intronic
905095510 1:35466775-35466797 AAAGAGTGAAAGATTCAGCTTGG - Intronic
906147838 1:43570418-43570440 AAAGAGGCTCAGAATCAGCTTGG + Intronic
906722400 1:48018488-48018510 GAAGAGCTACAGATTTATCTGGG + Intergenic
907096956 1:51790752-51790774 TAAGAGGCACGGATGAAGCTAGG + Intronic
907806108 1:57821975-57821997 GAAGAGGCTGAGGTTCAGCAAGG + Intronic
909085691 1:71167702-71167724 GAAGCTGCACAGATCCTGCTTGG + Intergenic
910564789 1:88631290-88631312 CAACAGGAACAGATTCAGGTGGG + Intergenic
914851659 1:151318885-151318907 GAAACGGCACAGCTTCAGCAGGG - Intronic
918591032 1:186241311-186241333 CAAGAGGTACAGTTTCAGATGGG - Intergenic
919725024 1:200876144-200876166 GATGAGGCTCAGATTCATCGAGG + Intergenic
920188779 1:204179215-204179237 GGACAGGCACAGAGTCAGCCTGG - Intergenic
920206434 1:204295726-204295748 TTAGAGGCTTAGATTCAGCTGGG + Intronic
921187877 1:212685396-212685418 GAAGGGGCTCAGATGCAGCGAGG - Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
923152801 1:231249039-231249061 GAAAAGGATCAGAATCAGCTGGG - Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067054805 10:43044319-43044341 GGAGAAGCACAGTCTCAGCTGGG + Intergenic
1067324709 10:45256422-45256444 GAAGAGGAACAGAGTCTGTTTGG - Intergenic
1068087669 10:52394954-52394976 GAATAGGAACAGATTTGGCTAGG - Intergenic
1068105446 10:52609237-52609259 GTAGAGGCAAAAATTCAGGTTGG + Intergenic
1069617453 10:69815216-69815238 GCAGAGGCCCAGGTTGAGCTAGG + Intronic
1070622280 10:78022318-78022340 GTAGAGGAACATCTTCAGCTGGG + Exonic
1071809172 10:89159958-89159980 GCATAGGCACAGATTCAGTGTGG - Intergenic
1072900437 10:99402311-99402333 GAAGTGGCTCAGAGCCAGCTGGG - Intronic
1073610192 10:104935642-104935664 AAAGAGGCACTGATTCTGCCCGG + Intronic
1074114740 10:110447295-110447317 GAAGGGACACAGAGTCAGCTAGG + Intergenic
1075127778 10:119714410-119714432 GAACAGGCACAGATCCTCCTGGG + Intergenic
1075455332 10:122581340-122581362 GAAGAGGCAGAGTTTGTGCTCGG + Intronic
1075457454 10:122594043-122594065 GAAGAGGCAGAGTTTGTGCTCGG + Intronic
1075581494 10:123621969-123621991 GAAGAGACACAGAACCACCTGGG - Intergenic
1075794578 10:125109996-125110018 GTTCAGGCAGAGATTCAGCTTGG + Intronic
1076512216 10:131020974-131020996 TAAGAGTCACAGAGTCACCTGGG - Intergenic
1076773833 10:132682087-132682109 GGACAGGAACAGTTTCAGCTGGG + Intronic
1077476886 11:2794692-2794714 GAGGAGGCACAAGTTCTGCTGGG + Intronic
1077609372 11:3635079-3635101 GAAGTAGAACAGATACAGCTTGG - Intergenic
1077806548 11:5596343-5596365 GAAGAGGCACCTTTGCAGCTGGG + Intronic
1080643928 11:34174577-34174599 CGAGCGGCTCAGATTCAGCTGGG + Intronic
1081051791 11:38350374-38350396 GAAGGGGCCCAGGTACAGCTTGG - Intergenic
1081620390 11:44615849-44615871 TAATGGGCACACATTCAGCTTGG - Intronic
1081995861 11:47363646-47363668 TAAGAGGCTAGGATTCAGCTGGG - Intronic
1082759320 11:57111624-57111646 CAAGAGGCACAGGTTGAGCTTGG - Intergenic
1082884426 11:58067901-58067923 GATGAGGCATTGATGCAGCTGGG + Intronic
1083224407 11:61275733-61275755 CAAGGGGCACAGAGTCAGCAGGG + Intronic
1083860098 11:65415779-65415801 CAAGGGGCACAGATAAAGCTGGG + Intergenic
1084941154 11:72614065-72614087 GAGGAGGCATAGAGTCAGCTTGG - Intronic
1085303098 11:75469862-75469884 GGAGAGACACAGATTTAGTTTGG - Intronic
1085540885 11:77268685-77268707 GCAGAGTCCCAGAATCAGCTTGG - Intronic
1092385768 12:8034419-8034441 GCAGAGGCATACATCCAGCTAGG - Intronic
1092855129 12:12666007-12666029 GAAGAGGTAAAGTTTGAGCTGGG + Intronic
1094379880 12:29831259-29831281 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1098419132 12:70272905-70272927 AAACAGGAACAGATTCAGGTAGG - Intronic
1100507054 12:95232472-95232494 GAATAAGCACAGATTCATATAGG + Intronic
1100724418 12:97393907-97393929 GAGAAGGCCCAGATTCAGTTGGG + Intergenic
1101917630 12:108908218-108908240 CAAGAGCCACAGATTCAGAGGGG + Intergenic
1104719968 12:131039756-131039778 GAAAGGGCCCAGACTCAGCTGGG + Intronic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105600295 13:21880686-21880708 GAAGTGGCTCAGATTCAGACAGG - Intergenic
1106793072 13:33175983-33176005 GAAGGAGCACAGATTCTGTTAGG + Intronic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1109139744 13:58699593-58699615 GAAGAAGAACAGAAACAGCTTGG + Intergenic
1109212322 13:59548464-59548486 GAAGAGGCACATTTTCCCCTGGG + Intergenic
1109503619 13:63270242-63270264 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1113017676 13:105846320-105846342 GTTGAGGCACAGAGTAAGCTGGG - Intergenic
1114460214 14:22881868-22881890 GAAGAGGCAAAGAATAATCTTGG - Intergenic
1115142259 14:30185583-30185605 TAAGAGTCACATTTTCAGCTTGG + Intronic
1116046191 14:39746013-39746035 GAAAAGGCAGAGTTTCAGCAGGG - Intergenic
1117455607 14:55894001-55894023 GCAGAGGCACTGATCCATCTTGG - Intergenic
1118337346 14:64865284-64865306 GAAGAGGCACAGAATGAATTGGG - Intronic
1120407050 14:84103275-84103297 GAAGAGGCCAAGGTACAGCTTGG + Intergenic
1121026755 14:90621597-90621619 GAAGCCACACAGGTTCAGCTGGG + Intronic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1125407823 15:39371388-39371410 AAAGAGGCCCAGATACAGTTTGG - Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1128242199 15:66108704-66108726 TGGGAGGCACAGAGTCAGCTGGG + Intronic
1128643750 15:69359967-69359989 GAAGCGGCACAGCACCAGCTAGG + Exonic
1129050283 15:72775690-72775712 TAAGAGGCAGGGTTTCAGCTGGG - Intronic
1129086702 15:73101502-73101524 GAAGAGGCAGAGATTAGGATTGG - Intronic
1132121964 15:99183977-99183999 GAAGGGGCAAAGGTACAGCTTGG + Intronic
1134091735 16:11395223-11395245 GATGAGGGACAGATTCAGGGAGG - Intronic
1134865904 16:17606877-17606899 AAGGAGGCACAGATTCAGAAAGG + Intergenic
1137548071 16:49417825-49417847 GAAGAGTGAGAGGTTCAGCTTGG + Intergenic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1139272474 16:65697226-65697248 TGAGTTGCACAGATTCAGCTGGG - Intergenic
1142681902 17:1554937-1554959 GGAGAGGCACAGGGACAGCTTGG - Intronic
1143259043 17:5584597-5584619 TCAGAGTCACAGATTCAGATGGG + Intronic
1143314910 17:6025222-6025244 GAAGAGACACAGCTTCAGCTTGG - Intronic
1148335106 17:46835755-46835777 AATGAGGAACAGATCCAGCTGGG + Intronic
1150006505 17:61472894-61472916 GAACAGGCACACATTCATATAGG - Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1152606746 17:81295240-81295262 GAAGAGCCGCAGAGCCAGCTAGG + Exonic
1152607107 17:81297258-81297280 TAAGAGACAGAGAGTCAGCTGGG - Intergenic
1152800763 17:82329719-82329741 GGAGAGGGACAGATTCCGCCTGG - Intronic
1153455040 18:5271433-5271455 AAAGAGGCCAAGATACAGCTTGG - Intergenic
1153666238 18:7369779-7369801 GAAGGGGCACAGGATCAGCCAGG - Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155231881 18:23782181-23782203 AAAGACTCAAAGATTCAGCTGGG - Intronic
1157700152 18:49757245-49757267 AAAGAGGAACAAAGTCAGCTTGG + Intergenic
1158554821 18:58466448-58466470 GAAGAGGCCCAGGCTCAGCATGG - Intergenic
1161301492 19:3544994-3545016 GGGGAGGCACAGGTTCAGCTTGG - Intronic
1165227514 19:34365331-34365353 GAGGCGGCGCAGGTTCAGCTCGG - Exonic
1165284882 19:34833266-34833288 GGAGAGGCACAGAGACAGCGAGG - Intergenic
1166965702 19:46528394-46528416 GATGAGGCTCAGTCTCAGCTGGG - Intronic
1167031371 19:46963507-46963529 GAAGAGGCACGCTTTCAGATGGG - Intronic
1167313418 19:48750683-48750705 GAAGAGGCGCAGAGTGTGCTGGG - Exonic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
927364445 2:22277530-22277552 GAGCAGGCACTGATTCTGCTTGG + Intergenic
929856814 2:45644244-45644266 GAGGAGTTACAGCTTCAGCTAGG + Intergenic
932448600 2:71795620-71795642 GAAGCTGAACAGATTCTGCTTGG + Intergenic
932448790 2:71796542-71796564 GAAGCTGAACAGATTCTGCTTGG - Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
935085784 2:99843362-99843384 GAGGAGGCTCAGAGGCAGCTGGG - Intronic
940661918 2:156556826-156556848 GAAGTGGCACAAGTTCATCTAGG + Intronic
941236532 2:162982521-162982543 AAGGAGGCACAGAATCTGCTAGG + Intergenic
942859511 2:180592164-180592186 GGAAAGGCACAGATTCAGTCAGG + Intergenic
945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG + Intergenic
945443576 2:209909733-209909755 GAGGAGTCACAGAGTCAACTAGG + Intronic
947853505 2:233307412-233307434 GGAGAGGGACAGATCCAGCTTGG + Intergenic
1169486154 20:6034814-6034836 GAAGAGGGACAGTTTCAGGAAGG + Intronic
1169492327 20:6081788-6081810 GAAAAGTGACATATTCAGCTAGG - Intronic
1172655092 20:36532003-36532025 GATCAGCCACAGATTCAGATGGG - Intergenic
1175883365 20:62273266-62273288 GGACAGGCACAGCTTCAGTTAGG - Intronic
1175992476 20:62796621-62796643 GAAGAGGCACACCTCCACCTCGG - Exonic
1176457286 21:6925009-6925031 GAAGAGGAAACTATTCAGCTGGG + Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1178616726 21:34141066-34141088 GAAAAGGAACAAATTCAGCAAGG - Intronic
1178943428 21:36926261-36926283 GCAAAGGGACAGCTTCAGCTCGG + Intronic
1179608032 21:42530908-42530930 GAAGTGGCTCAAATTCAGCATGG + Intronic
1182859817 22:33549439-33549461 AAAAGGGCACAGATTCAGTTAGG - Intronic
1184780257 22:46645239-46645261 GACAAGGCACAGGTTCTGCTGGG - Intronic
1185035208 22:48472027-48472049 GAAGAGGAACAGTTGGAGCTGGG + Intergenic
950074188 3:10175592-10175614 GAAAAGGTACAAAATCAGCTGGG + Intronic
950370644 3:12527033-12527055 GAAGAGGCAAAGATTGGGCAGGG + Intronic
950934496 3:16824831-16824853 CTAGAGGCTCTGATTCAGCTGGG - Intronic
952605914 3:35146375-35146397 GAAGAGGCCAAGGTGCAGCTCGG - Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952980373 3:38729203-38729225 GAAGAGGCCCATATTCAGGAGGG - Intronic
953002308 3:38947195-38947217 GAAGAGGCAGAAATTGAGCTTGG + Intronic
953382822 3:42486928-42486950 TAAAAGTCACAGAGTCAGCTGGG + Intergenic
954198930 3:49012842-49012864 GAAGGTGCACAGCTTGAGCTGGG + Exonic
954688130 3:52381692-52381714 GAAGAGGACCAGCTTCAGCTTGG - Exonic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
960241746 3:115350649-115350671 CAAGAGGCAGAGATCCTGCTAGG + Intergenic
961207445 3:125096262-125096284 GAAGATGCACTGTTTCAGGTAGG - Intronic
961365250 3:126395356-126395378 GAGGAAGCAGAGATTCAGCGAGG - Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
963326731 3:143871416-143871438 GTAGAGGCAGGGATGCAGCTGGG - Intergenic
964051010 3:152393574-152393596 GAAGAGGTACAAATAAAGCTGGG - Intronic
964341991 3:155717596-155717618 AAAGAGCCTCAGATACAGCTTGG - Intronic
965385644 3:168042896-168042918 GAAGAAGCCAAGATTCACCTGGG + Intronic
967174861 3:186853809-186853831 GAGGAGGCAGAGCTTCAGCTAGG + Intronic
968272999 3:197419052-197419074 GCACAGGCACAGGCTCAGCTTGG + Intergenic
969121614 4:4915286-4915308 GAAGAGTCCCAGATCCAGTTGGG - Intergenic
969144915 4:5114163-5114185 GGAGAGTGACAGGTTCAGCTGGG - Intronic
969941276 4:10734399-10734421 GAAGAGGGAAAGATTCGGCTGGG - Intergenic
970073828 4:12195358-12195380 AAAGGGGCCCAGATACAGCTTGG - Intergenic
970622788 4:17842316-17842338 GAAAAGTGACAGTTTCAGCTAGG + Exonic
972582155 4:40404528-40404550 GAAGAGACACAAACCCAGCTCGG - Intergenic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973784479 4:54322280-54322302 GAAGCGGAGCAGATTTAGCTTGG - Intergenic
973875944 4:55218604-55218626 GAAGAGGAAAAGATACAGGTAGG - Intergenic
974350979 4:60745517-60745539 GAAGAGGCACAGAGTAAGGGAGG - Intergenic
976428674 4:84936811-84936833 GAAAGGGTACAGATTCAGGTGGG - Intronic
977114375 4:93004393-93004415 GCATAGGCACAGATATAGCTAGG - Intronic
978682847 4:111403086-111403108 GAAGAGGCAAAACTTCAGTTTGG - Intergenic
980065734 4:128186882-128186904 AAAGGGGCCCAGATACAGCTTGG + Intronic
981578027 4:146225424-146225446 GAAGAGGCAGGGATTCTGATTGG - Intronic
982974539 4:162037450-162037472 GAAGAATCACACATACAGCTTGG + Intronic
984367054 4:178812949-178812971 GAGGTGTCACAGATTCTGCTCGG + Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985671203 5:1207583-1207605 GCAGAGGCTCAGAATCAGCCTGG - Intronic
985871792 5:2563108-2563130 GCAGAGGCCCTGATTCAGCAGGG - Intergenic
986265645 5:6187769-6187791 GATGAGGGACAGAGGCAGCTGGG + Intergenic
986771380 5:10977127-10977149 GAAGAGGCAAATACTCATCTTGG - Intronic
988191592 5:27943956-27943978 GAAGAAGCACAGTTTGAGGTGGG - Intergenic
988294527 5:29338059-29338081 GAAGAAGTACAGATTTAGGTGGG - Intergenic
989041135 5:37230886-37230908 GAAGAGGAATAAATTCTGCTGGG + Exonic
990482734 5:56227690-56227712 GAAGTGAAACAGATTTAGCTTGG + Intronic
991645357 5:68795619-68795641 GAAGAGGCAGAGAGGCAACTTGG - Intergenic
993010099 5:82471144-82471166 AAAGAGGCATAGATTGAGATAGG - Intergenic
993063759 5:83073823-83073845 GATGAAGCACAGCTCCAGCTTGG - Intronic
993527308 5:88981639-88981661 CAAGAGGGACAGAGTGAGCTAGG - Intergenic
994423187 5:99548175-99548197 GAAGAGACAGCGATCCAGCTTGG - Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994840911 5:104923955-104923977 GAAGAGGCCCAGGTACAGCTTGG + Intergenic
995333556 5:110973623-110973645 GGATAGGCACAGATTCAGACTGG - Intergenic
997192859 5:131955342-131955364 AAAGAAGCACAGATTCAGTAAGG + Intronic
998140028 5:139694553-139694575 GAGGAGGCCCAGTTTCATCTAGG + Intergenic
998186476 5:139983418-139983440 GAAGAGGAGCAGATCCAGATGGG - Intronic
999065916 5:148685320-148685342 GTAGTGGTACAGAGTCAGCTAGG - Intergenic
999214025 5:149916515-149916537 GAAGAGGCAGAGAGTTAGTTTGG - Intronic
1000965053 5:167646611-167646633 CAAGAGACACAAATTCAGCTAGG + Intronic
1002461360 5:179375567-179375589 GAGGAGGGACATCTTCAGCTGGG + Intergenic
1009831846 6:68947888-68947910 CAAGAGTAACAAATTCAGCTAGG - Intronic
1009985912 6:70780768-70780790 GAAGAGACACAGAGACAGCATGG - Intronic
1012072581 6:94641477-94641499 GACAAGGCACAGAGTCAGATAGG + Intergenic
1013318071 6:108960336-108960358 GAAGAGGCAGGGCTGCAGCTGGG - Intronic
1014866599 6:126539345-126539367 GAAGAGGCAAACTTTTAGCTTGG - Intergenic
1015449021 6:133342431-133342453 AAGGAAGCACAGATTCAGATCGG + Intronic
1015547265 6:134374271-134374293 TAAGAGGAAAATATTCAGCTTGG + Intergenic
1018510517 6:164519886-164519908 AAAGGGGCACTGATGCAGCTTGG + Intergenic
1021514872 7:21473148-21473170 GTAGAGGCACAGATTGAACAAGG + Intronic
1023902573 7:44494351-44494373 GTAGTGGCACAGTCTCAGCTCGG + Intergenic
1024258489 7:47557121-47557143 GAGGAGGCTCAGATCCACCTTGG + Intronic
1026172309 7:67964725-67964747 TAAGAAACACAGATTCAGCTGGG + Intergenic
1026844359 7:73689630-73689652 GCAGAGGCACAGATGCCGGTGGG + Intronic
1027997755 7:85447582-85447604 AAAGAGGCAGAGATTCCTCTTGG - Intergenic
1028363628 7:89999601-89999623 TAAGAGGAAGAGATTGAGCTAGG - Intergenic
1028894330 7:96023605-96023627 GATGAGGGTGAGATTCAGCTTGG - Intronic
1031404697 7:121370390-121370412 GAAGAGGCACATAAACAGCTAGG + Intronic
1032177777 7:129646608-129646630 GAAGAGGCACAGCTGGAGTTGGG + Intronic
1032277694 7:130474198-130474220 GAAAAGGAACATTTTCAGCTTGG - Intergenic
1032554395 7:132816654-132816676 GAGGAGGCACAGCAGCAGCTGGG - Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1035067505 7:156118553-156118575 GAAGAGGAACTCATTCAGCACGG - Intergenic
1035301928 7:157902903-157902925 GGAGAGGCTCACAATCAGCTTGG - Intronic
1036149572 8:6285043-6285065 GCAGAGGCTCAGATTTATCTTGG - Intergenic
1036550894 8:9814415-9814437 GGAGAAGCACAGATTCAACATGG - Intergenic
1036640468 8:10580239-10580261 GGTGAGGGACAGATTCAGCAGGG + Intergenic
1038513713 8:28165027-28165049 GAAGAGGCACTGATTTGGATGGG + Intronic
1038881648 8:31620122-31620144 GAAGAAAAACAGGTTCAGCTAGG + Intergenic
1043533650 8:81176582-81176604 AAAGGGGCACAGATACAGCTGGG - Intergenic
1045345012 8:101286053-101286075 GAAGAGGCACTCAGTTAGCTTGG - Intergenic
1045387585 8:101686487-101686509 AGTAAGGCACAGATTCAGCTGGG + Intergenic
1045393293 8:101736144-101736166 GAAGAGGAAAAGAGACAGCTCGG - Intronic
1047517101 8:125564471-125564493 GGAGAGGAATAGACTCAGCTTGG - Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048859786 8:138715776-138715798 GAAGAGGCAGGAATTCAGCTCGG - Intronic
1049333868 8:142071557-142071579 GAAGAGCCTCAGATTCAACAGGG + Intergenic
1049362098 8:142216689-142216711 GCAGAGGCACAGACTCAGGCCGG + Intronic
1051331306 9:16027388-16027410 AGAGAGGCACTGATACAGCTGGG + Intronic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878205 9:33583327-33583349 AAAGACGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497779 9:38560880-38560902 AAAGACGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054841121 9:69741305-69741327 GAAGAGAAACAGATTTAGGTAGG - Intronic
1055664684 9:78541600-78541622 GAAGAGGCAAAGATTCAAGCTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1058469398 9:105261746-105261768 AGAGAAACACAGATTCAGCTGGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1058970803 9:110081120-110081142 GAAGAGGCACTGCTTCAGCCTGG + Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061826223 9:133259955-133259977 GAAGGGGCACAGCGTCAGCCTGG + Intronic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185892227 X:3832006-3832028 GTAGAGGCAGAGATGCTGCTGGG - Intronic
1185897334 X:3870425-3870447 GTAGAGGCAGAGATGCTGCTGGG - Intergenic
1185902453 X:3908857-3908879 GTAGAGGCAGAGATGCTGCTGGG - Intergenic
1188673866 X:32914269-32914291 GAATAGGTACAGATTCAGAGTGG + Intronic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190618773 X:52264746-52264768 GATGAGGCCCAGATTCAGAGGGG + Intergenic
1193412689 X:81183465-81183487 AAAGGGGCCCAGATGCAGCTTGG + Intronic
1195834717 X:109101529-109101551 GAAGAGGCACAGAAAGAGATAGG - Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1199710712 X:150467214-150467236 GAAGAGACACAATTTCAGTTTGG + Intronic
1199758576 X:150887809-150887831 GAAGAGGCACACACGGAGCTAGG + Intronic
1199817997 X:151416925-151416947 GAAGAGGCACTTAATGAGCTGGG - Intergenic
1202253023 Y:22892530-22892552 GAAGAGTCACAGTCTCAGCCTGG + Intergenic
1202406013 Y:24526279-24526301 GAAGAGTCACAGTCTCAGCCTGG + Intergenic
1202464767 Y:25143802-25143824 GAAGAGTCACAGTCTCAGCCTGG - Intergenic