ID: 901819339

View in Genome Browser
Species Human (GRCh38)
Location 1:11816696-11816718
Sequence CTGGAGGGATGGTGGGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901819331_901819339 -4 Left 901819331 1:11816677-11816699 CCTGGTGAGGAGGCAGGGCCTGG 0: 1
1: 1
2: 7
3: 112
4: 847
Right 901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG 0: 1
1: 0
2: 2
3: 33
4: 260
901819325_901819339 15 Left 901819325 1:11816658-11816680 CCATTGGAGTCTGCACTGGCCTG 0: 1
1: 0
2: 1
3: 34
4: 266
Right 901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG 0: 1
1: 0
2: 2
3: 33
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901819339 Original CRISPR CTGGAGGGATGGTGGGCCAT AGG Intronic
900345608 1:2208915-2208937 GTGGAGGGATGGGGAGTCATGGG + Intronic
900414218 1:2527730-2527752 CTGGCAGCATGGTGTGCCATGGG + Intergenic
901497084 1:9628556-9628578 GTGGAGGGAGGATGGGCCAGTGG + Intergenic
901550008 1:9989137-9989159 CAGGATGGGGGGTGGGCCATGGG - Intergenic
901773999 1:11546671-11546693 CAGAGGGGCTGGTGGGCCATGGG + Intergenic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
902693619 1:18126040-18126062 CTTGAAGGATGGGAGGCCATAGG + Intronic
903579488 1:24360065-24360087 CTGGAGAGCAGGTGGGCCACAGG - Intronic
905178899 1:36155057-36155079 CTGGAGGGAAGGGGGGCAAGGGG + Intronic
905478294 1:38244251-38244273 GGGGAGGACTGGTGGGCCATGGG + Intergenic
907385079 1:54120952-54120974 CTGGAGAGATGGTGGTACGTGGG + Intergenic
907526461 1:55056767-55056789 CTGGAGGAGTGGTGGGTCAGAGG - Intronic
908688428 1:66751200-66751222 GGGTAGGGATGGTGGGCCAAAGG + Intergenic
912382805 1:109256397-109256419 CTGGAGGGTAGGTGGGCAGTCGG + Intronic
912392328 1:109312185-109312207 CAGGAGGGAGGGTGGGGCAGAGG + Exonic
913123814 1:115766780-115766802 CTGGAGGGATGGTAAGCCCAGGG + Intronic
913968651 1:143397242-143397264 CTGGACGGCAGGTGGGCCCTTGG - Intergenic
914063030 1:144222841-144222863 CTGGACGGCAGGTGGGCCCTTGG - Intergenic
914116120 1:144743513-144743535 CTGGACGGCAGGTGGGCCCTTGG + Intergenic
915401645 1:155626233-155626255 CTAGTGGGATGGGGAGCCATGGG + Intergenic
915737526 1:158094416-158094438 CATGAGGGCTGGTGGGCCAGTGG + Intronic
916016146 1:160751269-160751291 CAGGAGAAATGGTGGGCCAGTGG + Intronic
917149891 1:171932043-171932065 ATGGAGGGAGGGTGGGGGATGGG - Intronic
919370294 1:196715963-196715985 CTGGAAGGTAGGTGGCCCATAGG - Intronic
919371156 1:196727752-196727774 CTGCAGGGTTGGTGGGCCACAGG + Intronic
919840866 1:201608646-201608668 CTGGCAGGATGCTGGGCCTTGGG + Intergenic
920406538 1:205717624-205717646 TTGTAGGGAGGGTGGGCAATGGG - Exonic
923252626 1:232191614-232191636 ATGGGGGCATGGTGGGCCAAGGG - Intergenic
1062940192 10:1415073-1415095 GTGGATGGATGGTGGACCAATGG + Intronic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1065670725 10:28113930-28113952 GGGGAGGGATGGCGGGCCATGGG - Intronic
1065772872 10:29093967-29093989 ATGGAGGGAGGCTGGGGCATGGG - Intergenic
1066003021 10:31121908-31121930 CTGGAGGGATTGTGGGCCTGAGG + Intergenic
1066323979 10:34336284-34336306 GTGGAAGCATGGTGGGCTATGGG - Intronic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067132082 10:43574262-43574284 CAGGAGGGAGGAGGGGCCATCGG + Intronic
1067479974 10:46588278-46588300 CTGTGGGGAGGGTGGGCCATGGG - Intronic
1067614763 10:47753519-47753541 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1069142930 10:64850795-64850817 CAAGAGGGATTGTGGGCTATAGG - Intergenic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1070846109 10:79523831-79523853 CTGGAGGGAGCCTGGGCCCTGGG + Intergenic
1070927689 10:80236479-80236501 CTGGAGGGAGCCTGGGCCCTGGG - Intergenic
1071462897 10:85915110-85915132 CTGGTGGGATGGTCAGTCATGGG + Intronic
1071630169 10:87213482-87213504 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1074266569 10:111910295-111910317 CTGGAGTGATGGTGGGTGCTGGG - Intergenic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074817838 10:117156399-117156421 CAGGAGGGAGGGAGTGCCATAGG - Intergenic
1075741448 10:124698762-124698784 CTGGATGGAGGGTGGGGAATGGG - Intronic
1076302730 10:129440295-129440317 CTGGAGAGATTCTGGGCCAAAGG - Intergenic
1076317202 10:129550960-129550982 CTGGAGGGCAGGTGGGCCTCTGG + Intronic
1076379605 10:130015896-130015918 GCGGAGGGATGGTGGGGCCTCGG - Intergenic
1076680770 10:132170130-132170152 CCTGAGGGATGGTGGGCCTGCGG - Exonic
1076772770 10:132675656-132675678 CTGGAGGGAGCGTGTGCCCTTGG + Intronic
1076801808 10:132834434-132834456 CTGGAGGGACCGTGGGCAGTGGG + Intronic
1077020705 11:416040-416062 CTTGGGTGATGGTGGGCCTTGGG + Intronic
1077418144 11:2435480-2435502 ATGGAGGGATGGATTGCCATGGG - Intergenic
1077467462 11:2740210-2740232 CAGGAGGGAGGGTGGGGGATGGG + Intronic
1077543773 11:3160045-3160067 CTGGAGGGCTGGTGGGGCCAGGG - Intronic
1077915712 11:6610476-6610498 CTGGTGGGATGGTAGGCCGAAGG - Exonic
1078443590 11:11387393-11387415 CTGGAGGGATGGGGTGGCAAAGG - Intronic
1078877633 11:15414068-15414090 CGGGAGGGAAGATGGGACATGGG + Intergenic
1078899767 11:15630646-15630668 CTGGAAGGCTGGTGCTCCATGGG - Intergenic
1079123166 11:17699397-17699419 CAAGAGGGATCTTGGGCCATGGG - Intergenic
1079712550 11:23704698-23704720 GTTGGGGTATGGTGGGCCATGGG - Intergenic
1083407834 11:62471089-62471111 CTGCAGGGATGATGGCCCATGGG + Intronic
1083622408 11:64055707-64055729 ATGGATGGATGATGGGCCATGGG + Intronic
1083770633 11:64864896-64864918 CTGGATGGCTGGGGGGCCCTGGG + Intronic
1084472488 11:69371240-69371262 CTGGAGGTTTGGGGGGCCAGAGG - Intergenic
1084772038 11:71349610-71349632 CTGTGGGGATGGCAGGCCATTGG + Intergenic
1085320133 11:75568992-75569014 CTGGAGAGCTTGTGGGCCAGGGG - Exonic
1085341142 11:75732363-75732385 CTGGAGGGAAGGAGGGCCTGTGG + Intronic
1089329129 11:117677601-117677623 CTGGAGGGCTGCAGGACCATGGG + Intronic
1089566266 11:119373265-119373287 CAGGAGGGAGGAGGGGCCATAGG + Exonic
1089611329 11:119671181-119671203 CTGGAGGGATGGAGGGGGAGGGG - Intronic
1089843356 11:121438435-121438457 GTAGAGGGAGGGTGGGCCACAGG - Intergenic
1090144911 11:124311244-124311266 CTGGAGTGATGGTGGGCATGGGG + Intergenic
1090664340 11:128905130-128905152 CTGGAGGAAGGGCGGGCCAGCGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1092618486 12:10237223-10237245 ATGGGGGCAGGGTGGGCCATAGG - Intergenic
1093767547 12:22982340-22982362 ATGGGGGCAGGGTGGGCCATGGG - Intergenic
1096093811 12:48921089-48921111 CCCGGGGGATGGTGGGGCATTGG + Intronic
1097478033 12:60083645-60083667 ATGGAGTGATGGTGGGACTTGGG + Intergenic
1101353736 12:103957146-103957168 CTGCAGGGATGCTGGGCAACAGG + Exonic
1102222782 12:111205573-111205595 CTTGAGGGACTGTGTGCCATTGG + Intronic
1102572333 12:113834504-113834526 CTTTAGGCTTGGTGGGCCATAGG + Intronic
1104285854 12:127424036-127424058 CTCGAGGGATGGTCGGCTAATGG + Intergenic
1104298295 12:127539291-127539313 ATGGAGGGTTGGGGGGCAATAGG - Intergenic
1104724345 12:131066753-131066775 ATGGGGGGATCGTGGGGCATCGG + Intronic
1105467579 13:20660388-20660410 CTGGGGAGATGATGAGCCATTGG + Intronic
1105623830 13:22094005-22094027 CTGGAGGGAAGGTGGGCAGGTGG + Intergenic
1106221866 13:27753034-27753056 CTAAAGGTATGGTGGGCCCTAGG - Intergenic
1106475728 13:30096523-30096545 CTTGGGGGATGGTGGCCCAGAGG - Intergenic
1107037017 13:35912397-35912419 CTGGGGGTGGGGTGGGCCATAGG - Intronic
1107549028 13:41457932-41457954 GTGGAGGGAAGGTGGGACATGGG - Intronic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1113677094 13:112214841-112214863 CTGGAGGGGAGGAGGGACATGGG + Intergenic
1116861746 14:50001122-50001144 CTGCAGGGCTGGTGGGCTCTGGG - Intronic
1117003287 14:51393551-51393573 CTGTGGGAATGCTGGGCCATGGG - Intergenic
1118818333 14:69328247-69328269 CTGGAGTGATGGTGGTTGATGGG + Intronic
1120706067 14:87746985-87747007 CTGGAAGGCTGGTGGCTCATTGG - Intergenic
1123449560 15:20351336-20351358 CTGGAGGGACAGGGGGCCTTTGG + Intergenic
1124092213 15:26616160-26616182 CGGGAGGGAAGGTGGGCCTTGGG + Intronic
1125434877 15:39634010-39634032 CATGAGGGATGGTGGGGCACTGG - Intronic
1126087428 15:45023174-45023196 CTGGATGGAAGGTGGGGCCTGGG - Exonic
1127631519 15:60832267-60832289 CTGGAGGGGTGGTGTGGGATAGG - Intronic
1128745419 15:70110920-70110942 CTGGAGGCAGGATGGGGCATAGG - Intergenic
1129727252 15:77907747-77907769 CTGTGGGGAGGGTGGGGCATAGG + Intergenic
1129840628 15:78741271-78741293 CTGTGGGGAGGGTGGGGCATAGG - Intergenic
1131931571 15:97448709-97448731 TTGGGGGCAAGGTGGGCCATGGG - Intergenic
1132374605 15:101320707-101320729 CTGAAGAGATGGAGGGCCAGAGG + Intronic
1132688283 16:1171289-1171311 CTGGGGGGATCGTGGGGCTTTGG + Intronic
1133148225 16:3806747-3806769 TTGGAGGGAAGATGGGCCATCGG - Intronic
1133775878 16:8894743-8894765 CTGGGGGCTTGGCGGGCCATAGG - Intronic
1135705415 16:24670812-24670834 CTGAAGGGAGGGTGGACCCTTGG + Intergenic
1137569055 16:49552853-49552875 CTGGAGGGGTGGGGGCCCTTGGG - Intronic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1138100286 16:54246699-54246721 CTGGAGGCAGAGTGGGCCATGGG + Intronic
1138277182 16:55743551-55743573 CTGGAGTTATCGTGGGACATAGG + Intergenic
1138285863 16:55809872-55809894 CTGGAGTTATTGTGGGACATAGG - Intronic
1139486702 16:67261213-67261235 CTGGAGGGATCTTGGGCTGTGGG - Intronic
1142685845 17:1576565-1576587 GTCGGGGGATGGTGGGTCATGGG - Intronic
1143095234 17:4475338-4475360 CTGGAGGGATGGTGGGGCCTGGG + Intronic
1143124230 17:4631481-4631503 CTCTAGGGAGGGTGGGACATGGG + Exonic
1143473405 17:7190310-7190332 CTGCAGGGATGCAGGGCCACAGG - Exonic
1144747265 17:17624128-17624150 CATCAAGGATGGTGGGCCATGGG + Intergenic
1147247514 17:39132055-39132077 ATTCAGGGATGCTGGGCCATGGG + Intronic
1147459045 17:40556980-40557002 GTGAATGGATGATGGGCCATGGG + Intronic
1147662639 17:42125173-42125195 GTGGAGGGGTTGTGGGCAATGGG + Intronic
1147759303 17:42787434-42787456 CTGGGGGGACCGGGGGCCATGGG - Exonic
1148552271 17:48557579-48557601 CTGGAGGGCAGGAAGGCCATAGG - Intronic
1148748218 17:49930259-49930281 CTGGTGGGATGGGGGTGCATGGG + Intergenic
1148816759 17:50333508-50333530 CTGGAGGGATGATGAGGCAAGGG + Intergenic
1149549700 17:57531216-57531238 CTGGAGGGTTGTTGTGACATTGG + Intronic
1149809772 17:59657218-59657240 CTGGAGTTAAGGTGGGGCATGGG - Intronic
1150252303 17:63713360-63713382 ATGGAGGGAGGGTGGGCTCTTGG - Intronic
1151215672 17:72575052-72575074 CTGGAGGAGTGTTGGGCCATGGG - Intergenic
1151220733 17:72610698-72610720 CTGGAGGGAGGCATGGCCATTGG - Intergenic
1151901122 17:77016032-77016054 CATGATGGATGGTGGACCATAGG - Intergenic
1152224245 17:79085407-79085429 CTGGAGGGATGGAGGGGCCCTGG + Intronic
1152339071 17:79714554-79714576 CTGGAGGGACGGGGGGCCTTTGG - Intergenic
1152626057 17:81388449-81388471 CTGGAGGGCAGGTGGGCGGTGGG + Intergenic
1152734854 17:81992334-81992356 AGGGAGGGGTGGTGGGCAATCGG - Intronic
1152741295 17:82019613-82019635 CCGGAGGGAGCGTGGGCCCTGGG + Intronic
1153158762 18:2179455-2179477 CAGGGGGCAGGGTGGGCCATGGG - Intergenic
1156518851 18:37704472-37704494 CAGGAGGGCTTGTAGGCCATTGG + Intergenic
1157799267 18:50605717-50605739 CCGGAAGGAGGCTGGGCCATGGG - Intronic
1160185687 18:76674720-76674742 CTGGAGGGGAAGTGGGCCCTGGG + Intergenic
1160697635 19:492289-492311 CTGGGGGGATGGGGGTCCATGGG - Intronic
1160710428 19:548814-548836 GTGGGGGGAGGGTGGGCAATGGG - Intronic
1161138870 19:2636490-2636512 CTGGAGGGCTGGGTGGCCCTGGG - Intronic
1162077137 19:8195507-8195529 CTGGAGGGAAGATGTGGCATTGG - Intronic
1163020959 19:14480539-14480561 TGGGAGTGAGGGTGGGCCATGGG - Intronic
1163699557 19:18780564-18780586 CAGGAGGGATGGATGGACATGGG - Exonic
1164100508 19:22050803-22050825 CTGGAAGGAAGGTGGGCCAAAGG + Intergenic
1164581306 19:29437049-29437071 CTGGAGAGATGGAGGGCCTGAGG + Intergenic
1164887597 19:31795686-31795708 CTGGAGGCAGGTTGGGGCATGGG - Intergenic
1165434214 19:35787726-35787748 CTGGAAGGATGGGGGGCCCAGGG - Exonic
1166118131 19:40667923-40667945 CAGGAGGCATGGTGGGCACTGGG + Exonic
1167233775 19:48301731-48301753 CTGGATGGATGGATGGACATGGG + Intronic
1168350873 19:55674934-55674956 CAGGAGGGATGGTGGCCGAGCGG + Intergenic
1202702440 1_KI270712v1_random:174712-174734 CTGGACGGCAGGTGGGCCCTTGG - Intergenic
927104067 2:19809262-19809284 CTGGAGGACTTGGGGGCCATGGG - Intergenic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
931817574 2:65919885-65919907 CTGGAGGCATCTTGGGCCTTTGG + Intergenic
932006903 2:67936527-67936549 CTGGGGGGATGGGGGGCTAAGGG + Intergenic
934674401 2:96239480-96239502 CCAGAGGGGTGGTGGGACATTGG - Intergenic
934884748 2:98014565-98014587 CTGGTGGGCTGGTGGGCCGGTGG - Intergenic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
936327961 2:111521973-111521995 CTGGAGGGAAGCTGGCCCATAGG + Intergenic
940776672 2:157891987-157892009 ATGGAGGGAGGGTTGGCAATGGG + Intronic
947536388 2:230942635-230942657 GCAGAGGGAGGGTGGGCCATGGG + Intronic
948454604 2:238098995-238099017 CAGGAGGGGTGGTGGGCGGTGGG - Exonic
948829875 2:240593447-240593469 CTGGAGGCATGGAGGCCCAGGGG - Intronic
1168939278 20:1695126-1695148 GAGGAGGGAGGGTGGGCCAAGGG - Intergenic
1168947922 20:1777085-1777107 CTGGAGGGCTGTGGGTCCATAGG + Intergenic
1169067329 20:2701412-2701434 CTGCAGGGATGCTGAGCCCTGGG + Intronic
1170733543 20:18994152-18994174 CAGCAAGGATGGTGGTCCATTGG - Intergenic
1171996296 20:31734226-31734248 CTGGATAGATGGTGGGGCAAAGG - Intergenic
1175303865 20:57962501-57962523 CTGGAAGGATGGTGGACCCCCGG + Intergenic
1176362573 21:6010220-6010242 CTGGAGGGCTGCTGGGCTCTGGG + Intergenic
1177091778 21:16778468-16778490 CTGGAGTGATGGTGGGTCACTGG - Intergenic
1178731585 21:35107840-35107862 GTGCAGCTATGGTGGGCCATTGG + Intronic
1179487062 21:41717189-41717211 CTGGAGGGATGGAGGCCTTTAGG - Intergenic
1179760945 21:43528325-43528347 CTGGAGGGCTGCTGGGCTCTGGG - Intergenic
1182326918 22:29520183-29520205 CTGGATGGTTTGTGGGGCATGGG - Intronic
1183698565 22:39437177-39437199 CTGAAAGGATGGTGGGCCCAAGG + Intergenic
1184058504 22:42067877-42067899 CAGGATGGATGGCGGGACATGGG - Exonic
1185091593 22:48778650-48778672 GTGGAGGGATGCAGGGCCCTAGG + Intronic
1185109086 22:48890768-48890790 CTGATGGGATGGTGGGTCACTGG + Intergenic
1185148817 22:49152933-49152955 CTGGGGGGATGGGGGCCCCTAGG + Intergenic
1185175911 22:49326547-49326569 CTGGAGGGATGCTGAGCCCTCGG - Intergenic
1185377466 22:50488870-50488892 CAGGAGGGACGGGCGGCCATGGG - Intronic
1185377488 22:50488938-50488960 CAGGAGGGACGGGCGGCCATGGG - Intronic
1185377510 22:50489006-50489028 CAGGAGGGACGGGAGGCCATGGG - Intronic
949520103 3:4843731-4843753 ACGGAGGGAGGGTGGGCGATGGG + Intronic
949675472 3:6448070-6448092 CGGGGGGCAGGGTGGGCCATAGG + Intergenic
949941623 3:9159185-9159207 CTGGTGGGATGGTGGGTGGTGGG - Intronic
952959861 3:38582505-38582527 CTGGCGGCCTGGTGAGCCATGGG - Intronic
954388626 3:50257704-50257726 CTGGCGGGATGGTGAGCCAGAGG + Exonic
957583276 3:82104274-82104296 GTTGAGGGATGGGGGGCCAGGGG - Intergenic
961478657 3:127164974-127164996 CTGGAGAGATGCTGGGGAATTGG - Intergenic
966496062 3:180582066-180582088 ATGGAGGGATGGTGGAACATAGG + Intergenic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
968903272 4:3440830-3440852 ATGGAGGCGTGGTGGGCCCTGGG - Intergenic
969424876 4:7118310-7118332 ATGGAGGGATGGAGGGATATTGG + Intergenic
969424912 4:7118492-7118514 ATGGAGGGATGGAGGGATATTGG + Intergenic
969583992 4:8081448-8081470 GTGGAGGGATTGTGGGCCGCTGG - Intronic
971409947 4:26359674-26359696 CAGGAGGGATGGTGGCCGAGCGG + Intronic
983051626 4:163054778-163054800 CTGGAGGGGTGGTGGGTGAGGGG - Intergenic
985691409 5:1314735-1314757 CTGAAAGCATGGTGGGCCACAGG + Intergenic
985702604 5:1382552-1382574 CTGGAGGGGTGGGGGCACATTGG + Intergenic
986384343 5:7216926-7216948 CTGGAGGGGTCGGTGGCCATAGG + Intergenic
986462660 5:7989088-7989110 ATGGAAGGATAGTGGCCCATGGG + Intergenic
986862482 5:11943581-11943603 TTGGAGGTATGGAGGGCAATGGG + Intergenic
989657674 5:43761835-43761857 CTCAGGTGATGGTGGGCCATGGG - Intergenic
991485735 5:67134583-67134605 CCGGTGGACTGGTGGGCCATGGG + Exonic
996639600 5:125736282-125736304 CTGGAGGGATGGAGAGCCTCAGG + Intergenic
998449403 5:142222713-142222735 CTGGAGGAATTCCGGGCCATGGG + Intergenic
1000233423 5:159336088-159336110 GTGGGGGCAGGGTGGGCCATGGG - Intergenic
1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG + Intergenic
1003961254 6:11211258-11211280 CTGGAAGGACGGGGAGCCATGGG + Intronic
1004287942 6:14339875-14339897 CTGGAGAGAGTGTGGGCCAGGGG + Intergenic
1004495174 6:16156178-16156200 CTGGAGGCAGGGTGGGCCATGGG + Intergenic
1004692494 6:18004300-18004322 ATGGAGGGGTTGTGGGCAATGGG + Intergenic
1004779981 6:18897577-18897599 CTGGTGGGATGGTTGGCCTTAGG - Intergenic
1005277105 6:24231066-24231088 CTGGATGGAAGGCAGGCCATGGG - Intronic
1006148236 6:31971846-31971868 CTGGAGGGAGGGTGGGTGAAGGG - Intronic
1007049144 6:38808320-38808342 CTGTAGGGATGAGGGGCCATGGG - Intronic
1007259855 6:40555826-40555848 GGGGAGGGATGGGTGGCCATTGG - Intronic
1007662884 6:43497184-43497206 CTGGAGGGAAGGAGTGCCACTGG - Intronic
1008454477 6:51693279-51693301 ATGGAGGCATGGAGGGCCAATGG - Intronic
1009765859 6:68074599-68074621 TGGGTGGCATGGTGGGCCATAGG + Intergenic
1010175621 6:73024869-73024891 CTGGTGGGAAGGTGGGCAGTGGG - Intronic
1015715694 6:136189730-136189752 CTGGAGGGATGGTGGGGTGACGG - Intronic
1016076849 6:139805526-139805548 CTGTGGGGATGGGGGGCCAGGGG + Intergenic
1016833629 6:148455984-148456006 CTGGAGGGATGTGGGGCCTGGGG - Intronic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1017783218 6:157732856-157732878 ATGGAGAGATGTTGGGCCAAGGG - Intronic
1018397031 6:163386127-163386149 GTGAATGGCTGGTGGGCCATGGG - Intergenic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019178792 6:170174896-170174918 CTAGAGGGATGGTGGCACAGAGG - Intergenic
1019198793 6:170297161-170297183 CTGCAGGGTTGGTTGGCCGTGGG + Intronic
1019954116 7:4399503-4399525 CTGGAGGTATGGTGGGCCTGCGG + Intergenic
1020542330 7:9473910-9473932 CTGGAGGGATTGTGTACCCTAGG + Intergenic
1021100706 7:16584406-16584428 TATGAGGGATAGTGGGCCATGGG + Intergenic
1022236516 7:28467005-28467027 CTGGAGGGACAGGGGGCCAAGGG + Intronic
1022267857 7:28775207-28775229 CAGGAGGGATTGTGGGCAACGGG - Intronic
1024512883 7:50217040-50217062 CAGGCAGCATGGTGGGCCATGGG + Intergenic
1024517179 7:50268811-50268833 CAAGATGGATGGTGGGCAATTGG + Intergenic
1026010141 7:66629502-66629524 CAGGAGGGAGGGTGGGCCGTGGG + Intronic
1026129237 7:67606643-67606665 CAGGGGTGATGGTGGACCATTGG - Intergenic
1026495310 7:70896693-70896715 CTGGAGGGAGGATGGGTCAGTGG + Intergenic
1030060561 7:105617899-105617921 CTGGAGGGATGGCAGCCGATGGG - Intronic
1032090352 7:128908687-128908709 CTGGATGGTGGGTGGGCAATTGG - Intronic
1032150162 7:129422167-129422189 ATGGAAGGAGGGTGAGCCATTGG + Intronic
1032498585 7:132381851-132381873 CTGGAGGGATTGTGGGCTGCAGG - Intronic
1032785535 7:135196881-135196903 CAGGAGGGCTGGTGGGCCTAGGG - Intronic
1033029450 7:137811092-137811114 CTGGAGCAATGGTGTGCTATTGG + Intronic
1034904211 7:154929689-154929711 AGGGAGGGCTGGTGGGCCAGAGG - Intronic
1035636065 8:1145269-1145291 CTGGAGGGATGGTGGGTGGGTGG - Intergenic
1037323924 8:17669939-17669961 CTGGAGGCAAGGTGACCCATTGG + Intronic
1037804647 8:22052379-22052401 CTAGAGGGATGGTGGGGTGTTGG - Intronic
1038342433 8:26697777-26697799 CTGTAGGGATGGTGGACCAAGGG - Intergenic
1038606850 8:29015322-29015344 CAGGATGGAGGGTGGGCAATAGG - Intronic
1042157881 8:65864729-65864751 CTGAAGTAAGGGTGGGCCATGGG - Intergenic
1046709882 8:117499116-117499138 GTGGGGGCAGGGTGGGCCATAGG - Intergenic
1049305183 8:141899100-141899122 CTGGAGTCAGGGTGGCCCATGGG + Intergenic
1049846159 8:144802809-144802831 CTGGGGGGCTGGAGGGCCTTAGG + Intronic
1049971576 9:826510-826532 ATGGTGAGAGGGTGGGCCATGGG - Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050655981 9:7829583-7829605 CTGGATGGCTGATGGGCCTTAGG + Intronic
1052963307 9:34319178-34319200 CTGGAGAGCTTGTGGGCCAGGGG - Intronic
1056704394 9:88939754-88939776 CTGGAGGGAAGGTGGGAGAGGGG - Intergenic
1056767691 9:89454989-89455011 CTGCAGGGCTGCTGGGCCATGGG - Intronic
1057217112 9:93235176-93235198 CTGAAGGGATGGTGGTGCATGGG + Intronic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1058545414 9:106055924-106055946 ATAGAGCGATGCTGGGCCATGGG - Intergenic
1059053249 9:110952245-110952267 CTGGTGGGATTGTGGACCACTGG - Intronic
1060020928 9:120130445-120130467 CTGGAGTGACTGTGGGCCATGGG + Intergenic
1060942973 9:127553914-127553936 CTGGAGGTCTGATGGGTCATAGG + Intronic
1061003364 9:127915193-127915215 CCAGAGGGATGGAGAGCCATAGG - Intronic
1061516097 9:131091411-131091433 CCTGGTGGATGGTGGGCCATTGG + Intronic
1062318198 9:135978380-135978402 CAGGGGGGATGGTGGGGGATGGG - Intergenic
1062351541 9:136142140-136142162 CTGCAGGGAGGGCGGGCCCTGGG - Intergenic
1185923196 X:4116730-4116752 CTGGAGGGAAGGTGGGGGAGGGG + Intergenic
1188068254 X:25687736-25687758 ATGGAGGGAGGGTGGGGCAGGGG + Intergenic
1190327044 X:49212905-49212927 CTGGAGGGATGGAGGGACAGAGG + Intronic
1191201466 X:57786984-57787006 GTCGGGGGATGGTGGGCTATGGG + Intergenic
1192196617 X:69033017-69033039 CTGGAGGGATGGTGGGGGTGGGG - Intergenic
1192261679 X:69509321-69509343 CTGGGAGGATGGAGAGCCATGGG - Intronic
1192946377 X:75968471-75968493 CTGGAGTAAGGGTGGGGCATGGG + Intergenic
1193526171 X:82592123-82592145 TTTTAGGGATTGTGGGCCATGGG + Intergenic
1196137666 X:112227522-112227544 CTGTAGGGTTGGTGTGCCAGTGG + Intergenic
1197749120 X:129953031-129953053 CTGGAGGGGTGGAGGGCCAGAGG - Intergenic
1198119628 X:133579297-133579319 CTTGGGGGGTGGTGGGCAATGGG - Intronic