ID: 901820164

View in Genome Browser
Species Human (GRCh38)
Location 1:11823820-11823842
Sequence CAGTGTGGCTGGAGGTAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 481}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901820156_901820164 13 Left 901820156 1:11823784-11823806 CCGGACCCTGCTCTGCAAGGTCC 0: 1
1: 0
2: 2
3: 33
4: 269
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481
901820159_901820164 7 Left 901820159 1:11823790-11823812 CCTGCTCTGCAAGGTCCTTGGAG 0: 1
1: 1
2: 0
3: 26
4: 207
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481
901820158_901820164 8 Left 901820158 1:11823789-11823811 CCCTGCTCTGCAAGGTCCTTGGA 0: 1
1: 0
2: 1
3: 23
4: 192
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481
901820153_901820164 30 Left 901820153 1:11823767-11823789 CCAGGAATCGTCCGTCTCCGGAC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481
901820154_901820164 19 Left 901820154 1:11823778-11823800 CCGTCTCCGGACCCTGCTCTGCA 0: 1
1: 0
2: 1
3: 22
4: 281
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481
901820160_901820164 -8 Left 901820160 1:11823805-11823827 CCTTGGAGTGCTGTTCAGTGTGG 0: 1
1: 0
2: 2
3: 10
4: 178
Right 901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG 0: 1
1: 0
2: 3
3: 66
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901820164 Original CRISPR CAGTGTGGCTGGAGGTAAGA AGG Exonic
900377030 1:2359544-2359566 CACCGTGGGTGGAGGCAAGATGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904094226 1:27965266-27965288 GAGTGTGGCAGGGGGTAAGGGGG + Intronic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905312927 1:37063091-37063113 CAGTGACACTGGAGGTGAGAGGG - Intergenic
905753666 1:40488584-40488606 CAGCATGGCTGGAGGTAGGCTGG - Intronic
906460691 1:46033594-46033616 CAGAGTGGTTTGGGGTAAGAAGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
908083750 1:60608609-60608631 CAGTATGGCTAGAGGTAGGCTGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910846793 1:91611914-91611936 CAGTGTGGATGGGGGCAAGGAGG + Intergenic
910915749 1:92286845-92286867 TAATGTGGCTGAAGGTAAAAGGG - Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
913397654 1:118389747-118389769 TAGTGTGGCTGGAGTTATGAAGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915103367 1:153516271-153516293 CAGGGTGGGAGGAGGTAGGATGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916833342 1:168515273-168515295 TGGTGTGGCTGGAGTTGAGAAGG - Intergenic
919569987 1:199236203-199236225 CAGTTTGGCTGGAAATAAAAAGG + Intergenic
919669857 1:200328844-200328866 CCGTGTTCCTGGAAGTAAGAAGG - Intergenic
920170764 1:204071201-204071223 CAATCTAGCTGGAGGTAGGAAGG - Intergenic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920434310 1:205938310-205938332 CAGGGTGGGTGGAGGTATGGAGG - Intronic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924566338 1:245201827-245201849 CAGAGTAGCTGGGGGTAAAAAGG - Intronic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
1062917857 10:1255648-1255670 CGGTGAGGTTAGAGGTAAGAGGG + Intronic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065853985 10:29814893-29814915 TGGTGTGGCTGGAGCTCAGATGG + Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1069024876 10:63528704-63528726 CACTGTGGCTGGAGTTATAATGG - Intronic
1069221447 10:65888789-65888811 CAGTGTCTCTGGTGTTAAGATGG + Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1070183158 10:74033927-74033949 CAGTGTGAATGGAGATGAGAGGG - Intronic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073844423 10:107537577-107537599 AAGTGTGGAGGGAGGTAAGATGG - Intergenic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076876209 10:133217100-133217122 CAGTGTGGATGTAGTTAACACGG + Intronic
1077014056 11:392266-392288 CCGTGCGGCTGGAGCTATGATGG - Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1080249700 11:30219170-30219192 GTGTGCTGCTGGAGGTAAGAAGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1080411394 11:32028629-32028651 CAGTGTGGCTGGAAACAAGGAGG - Intronic
1080637180 11:34134360-34134382 CAGTCTGTCTCGAGGCAAGAAGG + Exonic
1081600364 11:44488509-44488531 CAGTGTGGCTGGCAGTCAGTGGG - Intergenic
1081620352 11:44615630-44615652 CAGTGTAGCTTGAGATAAGAGGG - Intronic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084918827 11:72452353-72452375 CAGTTTGCCAGGAGGTGAGAAGG + Intergenic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087902046 11:103651814-103651836 CTGTGACGCTAGAGGTAAGATGG - Intergenic
1088425883 11:109701930-109701952 CATTCTGACTGGTGGTAAGATGG - Intergenic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091181041 11:133605041-133605063 CACTGTGCCTGGAAGAAAGAGGG + Intergenic
1091695944 12:2628109-2628131 CAGTCAGGCTGGTGGCAAGAAGG - Intronic
1091863503 12:3808469-3808491 GCGAGTGGCTGGAGGTTAGATGG + Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092704838 12:11271160-11271182 CAGCTTGGCTGGAGGTATGATGG + Intergenic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1093471369 12:19505614-19505636 CAGCGTAGCTGGAGGGAACAAGG + Intronic
1093986028 12:25534519-25534541 CAAGGTGGCTGGAGGTCACAAGG + Intronic
1095719588 12:45386180-45386202 CACCCTGGCTGCAGGTAAGAAGG - Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096545802 12:52339463-52339485 GAGTGTGTCTGAAGGTGAGAGGG - Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1098885249 12:75954274-75954296 AAGTCTGGCTAGAGGTCAGAGGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099494637 12:83331790-83331812 AAGTGTGGTTTCAGGTAAGAGGG - Intergenic
1100282188 12:93128474-93128496 CACAGTGACTGGAGGTGAGAAGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1102098133 12:110256827-110256849 CAGTGTGGTTGCGGGTGAGAGGG - Intergenic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103281122 12:119758794-119758816 CAATTTGGCTAGAGGTAACAAGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1105884541 13:24630515-24630537 CAGAGAAGCTGGGGGTAAGAGGG + Intergenic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1113035477 13:106043096-106043118 CAGTTTCACTGGAGGTTAGAAGG + Intergenic
1113135630 13:107085901-107085923 AAATTTGGCAGGAGGTAAGATGG + Intergenic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1113361197 13:109633084-109633106 CTGTGTGGCAGAAGGTAAGGGGG - Intergenic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1118258919 14:64229500-64229522 CATTGTGGTGGGAGGTAAGGGGG + Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1119431830 14:74573429-74573451 AACTGTGGCAGGAGGTCAGAGGG + Intronic
1119521144 14:75286421-75286443 CAGAGTGCCTGTAGGGAAGAAGG - Intergenic
1120159641 14:81131550-81131572 CAGTGTTGCTGGTGCTGAGACGG - Intronic
1120471572 14:84932568-84932590 CAGTGTGATTGGAAGTGAGATGG + Intergenic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121333044 14:93059931-93059953 CAGTGTGGATGGGGGTGAGCAGG - Intronic
1121814921 14:96921823-96921845 CAATATGGCTGGAGGTCTGATGG - Intronic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125179996 15:36871525-36871547 AAGCCTGGCTGGAGGTCAGAGGG - Intergenic
1126575727 15:50194412-50194434 CAATGTGGTTAGAGGAAAGAGGG + Intronic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1127977646 15:64009967-64009989 CAGTTGGGCTGTGGGTAAGAGGG + Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128749757 15:70140522-70140544 CAGAGAGGCTGGAGGTAATGTGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129952792 15:79606953-79606975 CAGTGAAGCTGGTGGTCAGAGGG - Intergenic
1131040464 15:89260830-89260852 TACTGATGCTGGAGGTAAGATGG + Exonic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131635171 15:94225330-94225352 AAGTGTGACTGGAAGTCAGAAGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132662567 16:1068191-1068213 CAGTGTGGCTGATGGTGGGAGGG - Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133562182 16:6960570-6960592 GAGTTTGGAAGGAGGTAAGAAGG - Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1135169166 16:20167967-20167989 CAGTGTGTGTTGTGGTAAGATGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139371128 16:66470079-66470101 GAGTGAGGCTGAAGGTCAGAGGG + Intronic
1139412278 16:66773463-66773485 CAGTGTAGCTTGAGCTCAGAGGG - Intronic
1139599782 16:67979758-67979780 CATTGTGGCTGGGGGTGTGAAGG + Exonic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1143370718 17:6437301-6437323 CCGTGTGGCTGGAGAAAGGATGG - Intergenic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144256723 17:13475740-13475762 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1144517511 17:15928857-15928879 CAGAGTGGCTGGAGGTCTGGAGG + Intergenic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1147426199 17:40346985-40347007 CACTGTGTCTGCAGGTAAGGGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1148318118 17:46722291-46722313 GACTGAGGCTGGAGGTAAGAAGG - Intronic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1150975550 17:70082319-70082341 CAGAGTGGCAGGGGGTAAAATGG + Intronic
1151382960 17:73738159-73738181 CAGCGAGGCTGGAGCTATGAGGG - Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158475253 18:57774059-57774081 CAGGGTGGCTGTAGATGAGAGGG - Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159380774 18:67655550-67655572 CAGTGTTGTTGAAGGTAACAAGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160131745 18:76231492-76231514 CCCTGAGGCTGGAGGTAAGAAGG - Intergenic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1164518777 19:28960752-28960774 CTGTGAGGCTGGAAGCAAGATGG - Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165072689 19:33264685-33264707 CAGTCTGGCAGGAGGTGAGCAGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165719956 19:38072110-38072132 CTGTCTGACTTGAGGTAAGAAGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166338439 19:42122678-42122700 CAAGGTGGCTGGGGGTAAGGGGG - Intronic
1166913922 19:46181143-46181165 CAGTGAGGCTGGAAGCAAGATGG - Intergenic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925063892 2:914531-914553 AAGAGTGGGTGGAGGTTAGATGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926669490 2:15562815-15562837 CAGTGTGGCTGAAGGTAGTAGGG - Intergenic
927099115 2:19774362-19774384 CAGTGTAGATGGAGATATGAGGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
928239764 2:29576380-29576402 CAGTGTGCATGGTGGTAGGAAGG - Intronic
929020691 2:37549683-37549705 CAGGGTGGCTGAAGGAAACATGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929895957 2:45960996-45961018 CAGAGGGGCTGGAAGCAAGAGGG + Intronic
930226333 2:48797942-48797964 CAGTGTGGCTGGAACTTCGAAGG + Intergenic
930928889 2:56856482-56856504 CAGTGTAGCTTGAAGTCAGATGG + Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932263182 2:70344045-70344067 CAGAGTGGCTGCAGCTGAGATGG + Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932594019 2:73083162-73083184 GAGTGTGGCTTGGGGTAGGAAGG + Intronic
933024543 2:77238517-77238539 TAGTGTGGTTTGAGGAAAGAGGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933879024 2:86649349-86649371 CAGTCTGGCTGGTGGTAAGAGGG - Intronic
934714126 2:96533426-96533448 CAGATTGGCTGGAGGTTGGAGGG + Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
938161955 2:128994092-128994114 CAGTGTGGCTGGACATAATTTGG + Intergenic
938174492 2:129112345-129112367 CAGGGTGGCCTGAGGCAAGATGG + Intergenic
938237376 2:129717308-129717330 CAGCGTGGCTGCAGGTGAGCTGG - Intergenic
938262804 2:129907313-129907335 CACAGTGGCTGGAGATGAGAGGG + Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
940055550 2:149509156-149509178 CAGTGTGGCAGAAGTTAGGAGGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
943749120 2:191493680-191493702 CTGAGTGGCTGGAGATAAAATGG + Intergenic
944931666 2:204526487-204526509 CTGTGAGGTTGGAGGTAAGGTGG - Intergenic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948724394 2:239922825-239922847 CAGTGTGCCAGCAGGTAAGATGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169303786 20:4470605-4470627 TAGTGTGGCAGGAAGCAAGAAGG + Intergenic
1170463289 20:16599265-16599287 CAGTTTGGCTGCAGGTAAGTAGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1171338094 20:24405860-24405882 CAGGTGGGCTGGTGGTAAGAAGG - Intergenic
1172039408 20:32033251-32033273 CAGTGTTGTTTGTGGTAAGAGGG - Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173343369 20:42175302-42175324 CAGTGTGGCTGCAGCCTAGAGGG - Intronic
1173446683 20:43125343-43125365 CAGTGTGGGTGGTAGAAAGAGGG - Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1173844811 20:46181462-46181484 CTTTGTGGCTGGAGGAATGAGGG + Intronic
1174065206 20:47859808-47859830 CAGTGAGGCTGGAGGCAGCAGGG - Intergenic
1174087670 20:48020478-48020500 CAATGTGGCTGGAGGTAGATGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175428754 20:58888805-58888827 GTGGGTGGCTGGAGGTAAGGAGG + Intronic
1175723863 20:61303654-61303676 CAATGGCGCTGGAGGTGAGAAGG - Intronic
1175865712 20:62175287-62175309 CGGTGTGGCGGGAGGTGACAGGG + Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1177903049 21:26940174-26940196 CAGTATTGCTGAAGGTGAGAGGG + Intronic
1178112710 21:29385091-29385113 CATTGTGCCAGGAGGAAAGAAGG - Intronic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179142831 21:38741806-38741828 TAGTGTGGCTGGAACTAAGGGGG + Intergenic
1179580453 21:42340150-42340172 CAGTATGGGTTGAGGCAAGAAGG - Intergenic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181460728 22:23084543-23084565 CAGTGTGGCTGTCTGCAAGAAGG - Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183866408 22:40707751-40707773 CTGTGAGGCTGGAGGCTAGATGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184549699 22:45197941-45197963 CAGATCGGCTGGAGGAAAGAAGG + Exonic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951106149 3:18745626-18745648 CAGTCTGGCTGAACGGAAGAAGG - Intergenic
951577853 3:24131901-24131923 CAGTGAAGCTGGGGCTAAGAGGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953930952 3:47005409-47005431 TGCTGTGGCTGGAGGGAAGAAGG - Intronic
954574229 3:51666412-51666434 CAGGGTGGCTGGTGATAAGAGGG + Exonic
954681270 3:52347313-52347335 CAGTGTGGCTGGAGTCAGGGAGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
955870201 3:63430497-63430519 CAGTGTGGAAGTACGTAAGATGG + Intronic
957552583 3:81726353-81726375 GAATGTTGCTGGAAGTAAGAGGG + Intronic
957948893 3:87098373-87098395 CAGTGAGGGTGGAGCCAAGATGG - Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
959128682 3:102323276-102323298 GAGTGTGGCTGGTGCTAGGATGG + Intronic
959983566 3:112546832-112546854 CAGTGGGGCGGGGGGAAAGAAGG + Intronic
960253697 3:115487331-115487353 CAAAGTGGGTGGAGGTAGGAGGG - Intergenic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961535033 3:127565442-127565464 CAGTGTGGATTGAAATAAGACGG - Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
963460235 3:145603323-145603345 CAGTATGGCTGGATCTCAGATGG - Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
967232862 3:187357092-187357114 GAGTGTGGCATGAGATAAGAAGG + Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
971047546 4:22822153-22822175 AACTGTGGCAGTAGGTAAGATGG + Intergenic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977687181 4:99860270-99860292 TTGTTTGGGTGGAGGTAAGATGG + Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
980528421 4:134018502-134018524 GAAGGTGGGTGGAGGTAAGAGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981746234 4:148055058-148055080 CAGTGTGGAATCAGGTAAGAGGG - Intronic
982020569 4:151199612-151199634 CAGTGTGGCAGGAAAGAAGAGGG - Intronic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
982806850 4:159776603-159776625 CATTATGGCTGGCGGAAAGAAGG + Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985822716 5:2170806-2170828 CACTGTGGCTGCAGGTGAGCAGG + Intergenic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986738093 5:10682372-10682394 CAGTGTCGCTGGAGGAAGCATGG + Intronic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
991770000 5:70031445-70031467 CAGTTTGACTGGAGATGAGAAGG + Intronic
991849295 5:70906864-70906886 CAGTTTGACTGGAGATGAGAAGG + Intronic
992381707 5:76243851-76243873 CAGTGTGGCTGCATGTGAGTTGG - Intronic
993088974 5:83400121-83400143 GAATGTGGCTGAAGGTAATATGG - Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996566218 5:124881891-124881913 TTGTGTGGCTGCAGGAAAGAGGG - Intergenic
997381902 5:133444374-133444396 CAGGGTGGCTGTAGGTAAGGAGG - Intronic
997441510 5:133911844-133911866 CAGAGTGGAAGGAAGTAAGATGG - Intergenic
997608449 5:135193209-135193231 CAGAGTGGCTGGAAATAAAAGGG - Intronic
998156598 5:139790271-139790293 CAGTGTGGGTTGGGTTAAGATGG + Intergenic
998228793 5:140346274-140346296 CTTTCTGGCTGCAGGTAAGAGGG - Exonic
998250759 5:140550611-140550633 CAGTCTTGGTGGTGGTAAGAAGG + Exonic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999203637 5:149833305-149833327 CACTGCGGCTGGAGGTGAAAAGG + Exonic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1001120886 5:168979007-168979029 CAGCCTGACTGGAGGTAGGATGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1002936858 6:1681495-1681517 CAGTGTGGCTCCAGGTGAGGAGG + Intronic
1004325883 6:14673643-14673665 CCCTGTGGCTGGAGGTAAAGAGG + Intergenic
1004521917 6:16369342-16369364 CCATGTGGGTGGAGGTACGAAGG - Intronic
1005985653 6:30872904-30872926 CAGTGTCAGTGGAGGTAACATGG - Intergenic
1006848135 6:37077621-37077643 CTGTGTGGCTGCAGGTCAGGAGG - Intergenic
1007085904 6:39145093-39145115 CAGTGTGGCTTGACCTAAGTGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009350420 6:62669823-62669845 CAGTGTTGCTGCATGTAGGAGGG - Intergenic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1012952385 6:105532263-105532285 CAATTTGGCTGGAGCTCAGAGGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014212253 6:118719480-118719502 CAGGGTAGCTGGAGGTCACAAGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015154554 6:130077688-130077710 CAGTGTGGCTGGAGTTTCCAGGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017437951 6:154435554-154435576 CACAGTGGCGGGAGGTGAGAGGG - Intronic
1017660624 6:156670272-156670294 CAGGGTGGCTGCCGGTCAGAGGG - Intergenic
1017818394 6:158031342-158031364 CTCTGTGGCTGGAGGTGTGAGGG + Intronic
1017821877 6:158054870-158054892 CAGCCTGGCTGGGAGTAAGAAGG + Intronic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019254680 7:41705-41727 CTGTGAGGCTAGAGGTAAGGTGG - Intergenic
1021108346 7:16665577-16665599 CAGTGAGGCTGGGGGAAACAGGG - Intronic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023812701 7:43924726-43924748 CAGGTGGGCTGGAGGTAGGAAGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024237682 7:47410195-47410217 CCCTGTGGCTGGAAGTGAGAGGG - Intronic
1025092311 7:56074293-56074315 CAGTGTTCCTGGATGTACGAGGG - Intronic
1025109629 7:56203205-56203227 CAGTGTGGCTATAGGTGGGATGG + Intergenic
1026795516 7:73363908-73363930 CAGTGTTGCTGGGGGAATGAAGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030321739 7:108176421-108176443 AACTGTGGATGAAGGTAAGATGG - Exonic
1030412848 7:109203510-109203532 CAGGGAGGAAGGAGGTAAGAAGG + Intergenic
1030916881 7:115326009-115326031 CAGTGTGGTTGGCGGTAGGGTGG + Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034515064 7:151570037-151570059 CAGTGTAGCTGGAATTAAGGAGG + Intronic
1034819739 7:154205819-154205841 CTTTGTGGCTGGCAGTAAGAGGG - Intronic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038814647 8:30888887-30888909 CATTGTGGCTGAATGGAAGAAGG - Intronic
1038893316 8:31752295-31752317 CAGAGTGACTGGAGCTAAGTGGG + Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039446188 8:37635052-37635074 GAGGGTGGCTGGGGATAAGATGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042989808 8:74626441-74626463 CTCTGTGGATGGAAGTAAGAGGG + Intronic
1044236690 8:89839537-89839559 GAGTGAGGGTGGGGGTAAGAGGG - Intergenic
1044280477 8:90349656-90349678 CAGTTTGACTGGTGGGAAGAGGG + Intergenic
1044429878 8:92095942-92095964 CTGTTTGGATGGAGGTGAGATGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045648651 8:104323351-104323373 CAGGGGAGTTGGAGGTAAGAAGG - Intergenic
1045733825 8:105272245-105272267 CAGTTTGGGTGGAGGTAATGGGG + Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1051056803 9:12997073-12997095 CAGTGTATTTGTAGGTAAGAAGG - Intergenic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1053467110 9:38316636-38316658 CAATGTGGCTGCAGGAAGGATGG + Intergenic
1053807842 9:41821592-41821614 CAGGGAGGCAGGAGGTCAGAGGG - Intergenic
1054622750 9:67365836-67365858 CAGGGAGGCAGGAGGTCAGAGGG + Intergenic
1055774076 9:79749102-79749124 CAGTGGGGCTGGAATTAACAAGG + Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057293000 9:93819057-93819079 AAGTGCTGCTGGAGTTAAGACGG + Intergenic
1057400823 9:94721458-94721480 CTGTGAGGCTGGAAGCAAGATGG + Intergenic
1057534556 9:95886856-95886878 CAGCGTGGCTAGAAGTAAGCAGG + Intronic
1057818269 9:98311679-98311701 CAGTGGGGCTGTGGGCAAGAGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059533681 9:115061346-115061368 TGGTGTGCCTGGAAGTAAGAGGG - Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062298429 9:135848157-135848179 CAGTGTTTCTGGCTGTAAGATGG + Intronic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1189213003 X:39300548-39300570 CACTGTGGCTGCAGGTAACTTGG + Intergenic
1190212472 X:48459452-48459474 CAGGATGGCTGGAGGTGAAAGGG - Intronic
1190566846 X:51739147-51739169 CAGTGATGCTAGATGTAAGATGG + Intergenic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1191911793 X:66159686-66159708 TAGTGTGGCTGGAAGTAGGCAGG + Intergenic
1192047860 X:67695425-67695447 CAGTAAGGCTAGATGTAAGAGGG - Intronic
1192169909 X:68847746-68847768 CAGAGTGGCTGGTGGTATTAGGG - Intergenic
1192491533 X:71579981-71580003 CAGAGTGGCGGGAGGTAAGGGGG + Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197270048 X:124415366-124415388 AATTCTGGCTGGAGTTAAGAAGG + Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198925949 X:141795657-141795679 CAGTCTTGATGGAGGCAAGAGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199872940 X:151914007-151914029 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199873467 X:151916051-151916073 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199874173 X:151918770-151918792 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1201781292 Y:17725378-17725400 CAGTGAGGGTTAAGGTAAGAGGG - Intergenic
1201820261 Y:18180612-18180634 CAGTGAGGGTTAAGGTAAGAGGG + Intergenic
1202306214 Y:23473688-23473710 CAGTGTGGAAGGGGGAAAGATGG + Intergenic
1202564595 Y:26196901-26196923 CAGTGTGGAAGGGGGAAAGATGG - Intergenic