ID: 901821982

View in Genome Browser
Species Human (GRCh38)
Location 1:11836073-11836095
Sequence CCGCGGTTCTCTGTGACCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901821982_901821987 1 Left 901821982 1:11836073-11836095 CCGGTGGTCACAGAGAACCGCGG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 901821987 1:11836097-11836119 AACGAGAAGGAGTTCATGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 149
901821982_901821986 0 Left 901821982 1:11836073-11836095 CCGGTGGTCACAGAGAACCGCGG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 901821986 1:11836096-11836118 TAACGAGAAGGAGTTCATGAAGG 0: 1
1: 0
2: 0
3: 13
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901821982 Original CRISPR CCGCGGTTCTCTGTGACCAC CGG (reversed) Exonic