ID: 901825473

View in Genome Browser
Species Human (GRCh38)
Location 1:11858463-11858485
Sequence GCTGCTCCTGCAATGAATGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901825469_901825473 -8 Left 901825469 1:11858448-11858470 CCTGCAAATGGTTGCGCTGCTCC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG 0: 1
1: 0
2: 3
3: 12
4: 148
901825468_901825473 -7 Left 901825468 1:11858447-11858469 CCCTGCAAATGGTTGCGCTGCTC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG 0: 1
1: 0
2: 3
3: 12
4: 148
901825466_901825473 4 Left 901825466 1:11858436-11858458 CCGACAGTTTGCCCTGCAAATGG 0: 1
1: 1
2: 0
3: 14
4: 125
Right 901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG 0: 1
1: 0
2: 3
3: 12
4: 148
901825465_901825473 13 Left 901825465 1:11858427-11858449 CCTGCAGCTCCGACAGTTTGCCC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG 0: 1
1: 0
2: 3
3: 12
4: 148
901825464_901825473 16 Left 901825464 1:11858424-11858446 CCACCTGCAGCTCCGACAGTTTG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG 0: 1
1: 0
2: 3
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901825473 Original CRISPR GCTGCTCCTGCAATGAATGG GGG Exonic
900288291 1:1912503-1912525 ACTGCTGCTGCAATGAATATGGG - Intergenic
900309677 1:2027687-2027709 GCTTCTCCAGCAGTGGATGGGGG + Intronic
901059019 1:6463121-6463143 GGTGCTCCTGCAAGGGACGGGGG + Exonic
901825473 1:11858463-11858485 GCTGCTCCTGCAATGAATGGGGG + Exonic
902089805 1:13893978-13894000 GCTGCTTTTGCAATGAGTGAGGG + Intergenic
903384601 1:22918178-22918200 GCTTCTCCTGGAATAAATGAGGG - Intergenic
905232767 1:36525354-36525376 GCTGCACCTGTAATGAATGGTGG + Intergenic
913070735 1:115296190-115296212 ACTCCTCTTGCAATGCATGGTGG - Intronic
917721719 1:177792351-177792373 GCATCTCCTGCAGTGAATTGGGG - Intergenic
918379463 1:183939810-183939832 GCTGCTCCATCAATGAATTTAGG + Intronic
921268071 1:213442575-213442597 GCTGCTCCTGAATTGTATTGTGG + Intergenic
921803121 1:219424643-219424665 GCCTCTGCTGCAATGAATGGAGG - Intergenic
923045681 1:230354071-230354093 GCTGCTGCTCCAGGGAATGGAGG + Intronic
923239354 1:232066299-232066321 GATGTTCCTGCAATGCAGGGAGG + Intergenic
923284609 1:232481279-232481301 GATGCTCCTTCAATGAATAATGG + Intronic
924501635 1:244643823-244643845 ACTGCACGTGCAAGGAATGGAGG + Intergenic
924722739 1:246638379-246638401 GTGGCCCCTGCAATGAATGACGG + Intronic
1065387763 10:25150276-25150298 GCTGCTACTGCACTGAATAAGGG + Intergenic
1065396707 10:25247092-25247114 GCTAGTGCTGAAATGAATGGTGG - Intronic
1065459112 10:25937146-25937168 GCTTCTCCTGAAAAAAATGGAGG + Intronic
1069239671 10:66123818-66123840 GCTGCTCCAGCCATGAATAAAGG - Intronic
1069313388 10:67067454-67067476 ACTGGTCCTGAAATGAATTGTGG - Intronic
1072283872 10:93894454-93894476 GCTGCTCCTGTAATTAGTGTCGG + Intronic
1072566997 10:96625049-96625071 GCGGATGGTGCAATGAATGGTGG + Intronic
1074615392 10:115062244-115062266 GCTGCTCCTGGAATGCAGGGTGG + Intergenic
1074800957 10:117000725-117000747 GCAGCCCCTGCAAAGATTGGAGG - Intronic
1074843295 10:117375483-117375505 GCTGCTCGTCCAATGAGTGGAGG - Intergenic
1075578741 10:123599831-123599853 GCTGCTCCTGCAAGTCCTGGTGG - Intergenic
1076112457 10:127871723-127871745 GCAGATGCTGCAATGGATGGTGG + Intergenic
1077174587 11:1182922-1182944 CCTGCTCCTGGAATAAATGGTGG + Intronic
1077174802 11:1184041-1184063 CCTGCTCCTGGAATAAATGGTGG + Intronic
1079231314 11:18651253-18651275 CTGGCTCCTGCAATGCATGGCGG - Intergenic
1079546396 11:21637890-21637912 GCTGATCCTGAAATTAATAGGGG + Intergenic
1080646886 11:34193980-34194002 GCTGCTTCTGCAGTGTTTGGTGG - Intronic
1084095933 11:66911393-66911415 GCTGCTCCTGTAAAGAAGGCTGG - Intronic
1087048641 11:93865305-93865327 GTGGCCCCTGCAATGAATGATGG + Intergenic
1090438011 11:126702920-126702942 GCTGACCTTGCAAGGAATGGAGG - Intronic
1094569568 12:31629746-31629768 GGTACTCCTGCAATGGAGGGAGG - Intergenic
1095150377 12:38787339-38787361 TATGCTCCTGAAATGAATGGTGG + Intronic
1099861896 12:88232283-88232305 GTGGCCCCTGCAATGAATGATGG - Intergenic
1100216701 12:92457580-92457602 GGAGGTGCTGCAATGAATGGGGG - Intergenic
1100619775 12:96259771-96259793 GCTGCTCCAGAAATGTATGCTGG - Exonic
1106868954 13:33998025-33998047 GCTACTCCTGCTTTGAATGATGG - Intergenic
1110797870 13:79660806-79660828 TCTGCTCTTGAAATGACTGGAGG + Intergenic
1112470959 13:99688715-99688737 CCAGCTCCTGCATGGAATGGAGG + Intronic
1114657148 14:24322989-24323011 GCTGCTCCTGCTGTGGCTGGCGG - Exonic
1116768046 14:49096253-49096275 GCCTCTCCTGCAATGAGTAGAGG + Intergenic
1117714384 14:58565533-58565555 GCTGCTCCTGAAGTGAATTTGGG + Intergenic
1118942271 14:70348837-70348859 GTGGCCCCTGCAATGAATGAAGG - Intronic
1119079154 14:71675705-71675727 GCTGCAGCTGCAGTGACTGGTGG - Intronic
1119959199 14:78835325-78835347 GCTGCTCCTGCAGTTGGTGGTGG + Intronic
1125583438 15:40803757-40803779 GCTGCTCCTGCCTTTAATGGGGG - Intronic
1126348085 15:47717519-47717541 GCTGCTGCTGCAAGGGGTGGTGG + Intronic
1128599234 15:68981634-68981656 GGTGTTGATGCAATGAATGGGGG + Intronic
1128751329 15:70152266-70152288 GCTGGTCATGCAGTGAATTGTGG + Intergenic
1128803594 15:70513923-70513945 GCTGCACCTGCACTGCATGGGGG + Intergenic
1132069926 15:98767369-98767391 GTTGCTCCTGCTATGAAGGATGG + Intronic
1135634294 16:24060841-24060863 GGAACTCCTGCAAGGAATGGGGG - Intronic
1135758409 16:25117040-25117062 GCTGCTCAGGCAGTGAATCGTGG + Intronic
1137071148 16:35905879-35905901 GTGGCCCCTGCAATGAATGATGG + Intergenic
1137618441 16:49859766-49859788 GCTGCTCCTGCCCTGCTTGGAGG + Intergenic
1143076029 17:4344080-4344102 GCTCCTCCTTCAATAAATGAAGG - Intronic
1144864115 17:18323911-18323933 GCTGCTCCTCCCTTGCATGGTGG - Intergenic
1146227333 17:31078345-31078367 GCTGCTCCAGCAGGGAATGATGG + Intergenic
1146522001 17:33532604-33532626 GGTGCTAGTGCAATGGATGGGGG + Intronic
1148742423 17:49900372-49900394 GCTGCTCCTCCCCTGAAAGGTGG + Intergenic
1148804575 17:50257723-50257745 CCTGCCCCTGCAGTGCATGGAGG - Intergenic
1148957977 17:51369807-51369829 TCCCCTCCTGCAGTGAATGGAGG - Intergenic
1149920049 17:60649397-60649419 ACTGCGCCCGGAATGAATGGAGG - Intronic
1152428532 17:80233415-80233437 ACTGTTCCTGCAGGGAATGGTGG - Intronic
1154997032 18:21649971-21649993 GCTGATCCTGCCATGGATGCTGG - Intergenic
1157299008 18:46466403-46466425 GCTGCTCTTGCAAGGATTGCAGG + Intergenic
1157301163 18:46480626-46480648 GCTGCTCCTGCTAGAAAGGGGGG + Intronic
1157920354 18:51707745-51707767 GTGGCCCCTGCAATGAATGATGG - Intergenic
1159160501 18:64638211-64638233 TCCGCTTCTGCATTGAATGGGGG - Intergenic
1159545484 18:69835507-69835529 GCTCTTACTGCAATGAATTGGGG - Intronic
1160596046 18:79975076-79975098 GCTCCTTCTACAATGACTGGGGG + Intronic
1161124445 19:2547851-2547873 GCAGCACCTGCTATGGATGGAGG - Intronic
1161939858 19:7395411-7395433 GCTGCTCCTTCAATGCATGGAGG + Intronic
1167233974 19:48302799-48302821 GCTGCTCCTGCAGCAAATGCTGG + Exonic
927853522 2:26514230-26514252 ACTGCCCCTGCAATGCAGGGTGG + Intronic
928429432 2:31205493-31205515 GCTGCTCCTGAAATGGAGAGAGG + Exonic
932774572 2:74519992-74520014 GCTTCTTCTGCACTGAGTGGAGG + Exonic
933167754 2:79094440-79094462 GTGGCCCCTGCAATGAATGATGG + Intergenic
934584644 2:95480292-95480314 GCTGCTCCAGGTAAGAATGGAGG - Intergenic
934594808 2:95596423-95596445 GCTGCTCCAGGTAAGAATGGAGG + Exonic
939496380 2:142932471-142932493 GTGGCCCCTGCAATGAATGATGG + Intronic
947578646 2:231296947-231296969 GTTACTCCTGCAGTGAATGCTGG + Intronic
948831170 2:240598873-240598895 GCTGGTGCTGCAAGGAAGGGTGG + Exonic
1168914771 20:1476726-1476748 CCTGCTCCTGCCATTCATGGGGG - Intronic
1175132316 20:56798603-56798625 GCAGTTCCTCCATTGAATGGAGG + Intergenic
1176815401 21:13595913-13595935 GCTGCTCTTGCAACTAAAGGTGG + Intergenic
1179308270 21:40174612-40174634 GCTGATCCTTCAATGAATGGAGG + Intronic
1179997218 21:44979580-44979602 TCTGCACCTGCAAAGAATGCTGG - Intergenic
1180141198 21:45894183-45894205 GCTGCCCTTGCAATGAAGAGAGG + Intronic
1181942404 22:26488564-26488586 GCTGCCACTGCAAAGAATGCTGG - Intronic
949905118 3:8852635-8852657 GCTGCTCCAGAAAGGAAGGGAGG - Intronic
952591605 3:34961987-34962009 GCTCCTGCTGGAAAGAATGGGGG - Intergenic
953860364 3:46539174-46539196 TCTGCTCCTTCAATGAATCTGGG + Exonic
954558003 3:51533389-51533411 GTGGCCCCTGCAATGAATGATGG + Intergenic
954686057 3:52370878-52370900 GCTGTTCCCGCAATGAATTATGG + Intronic
955973645 3:64460732-64460754 GGTGCTGCTGGAAAGAATGGGGG - Intergenic
957743041 3:84299419-84299441 GCTGCTCATCCAAAGAAAGGAGG + Intergenic
961786285 3:129349016-129349038 GCTGGGCCTGCAAGGAGTGGCGG - Intergenic
962927519 3:140008530-140008552 GCTGTTCTTGCAATGTGTGGGGG + Intronic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
967428387 3:189353682-189353704 GCAGCTCCTGAAAAGAATGTTGG + Intergenic
967469097 3:189842175-189842197 GCTGCTACTGCAGTGGAAGGGGG + Intronic
968685540 4:1955771-1955793 GCTGGTTCTGCAATGACTGCAGG + Exonic
968981921 4:3854808-3854830 GCTGCTCCTGAAATGAGGTGTGG - Intergenic
969849982 4:9948440-9948462 GCGTCACCTGCAGTGAATGGTGG + Intronic
970794158 4:19891926-19891948 GTGGCCCCTGCAATGAATGATGG - Intergenic
971058641 4:22941781-22941803 GCAGATCCTGCAATGTCTGGTGG - Intergenic
972035014 4:34508982-34509004 GCTGTTGCTGATATGAATGGTGG + Intergenic
973052413 4:45611665-45611687 GTGGCCCCTGCAATGAATGATGG - Intergenic
974959143 4:68676602-68676624 GTGGCCCCTGCAATGAATGATGG - Intergenic
980828316 4:138098599-138098621 GCTCCTCTTGTAATGAATGCAGG - Intergenic
984829748 4:183961376-183961398 GCTGCTGCTGCATAGAACGGTGG + Intronic
985227075 4:187773067-187773089 TCTTCTCTTGCAATGAATGAAGG - Intergenic
985807893 5:2060529-2060551 GCAGAGCCTGCAAGGAATGGAGG + Intergenic
989378455 5:40790149-40790171 CCTGCTCCTGTTATGTATGGAGG - Intronic
990185464 5:53205494-53205516 GTGGCCCCTGCAATGAATGATGG - Intergenic
996838974 5:127825516-127825538 GCCACTCATGCCATGAATGGAGG - Intergenic
1005983882 6:30858308-30858330 GCTGCTCCTGGTGAGAATGGAGG + Intergenic
1006420362 6:33930117-33930139 GCCAGTCATGCAATGAATGGGGG + Intergenic
1008629982 6:53354689-53354711 ACGGCTCCTGCAAAGAAGGGTGG + Intergenic
1009871738 6:69461085-69461107 GTTGCTCCTGCAATGAACAATGG + Intergenic
1011751286 6:90457651-90457673 CTTCCTCCTGCCATGAATGGAGG - Intergenic
1012568303 6:100688831-100688853 GTTGTTCATGTAATGAATGGTGG - Intronic
1015820887 6:137259303-137259325 GCTGCTTCTCCAGTGAATGAAGG - Intergenic
1017148668 6:151258160-151258182 GCCGCTCCTGCAATGAATACTGG + Intronic
1017324062 6:153127095-153127117 GCTGCGCATGCAAGGAATTGAGG - Intronic
1018072265 6:160175140-160175162 GCTGCTCTTGACATGACTGGTGG + Intronic
1019328218 7:449909-449931 GCATCTCCTGCCATGAATTGAGG - Intergenic
1022898786 7:34781218-34781240 ACTTCCTCTGCAATGAATGGGGG + Intronic
1022962077 7:35437005-35437027 GCTCTTCCTACAATGAGTGGTGG - Intergenic
1027483663 7:78731713-78731735 GCTGCTCATGAAATGAGTGGGGG + Intronic
1029358594 7:100071530-100071552 CCTACGCCTGCAATGAATGTGGG - Exonic
1033719068 7:144037664-144037686 GCTGCTGCTGTAATTAATTGTGG + Intergenic
1034265490 7:149778782-149778804 GCTGAGCCTGCAATGGCTGGGGG + Intergenic
1034941788 7:155235512-155235534 GCTCCTCATGCAGTGAATTGTGG + Intergenic
1035956857 8:4089830-4089852 GAGGCTTCTGGAATGAATGGTGG + Intronic
1039076153 8:33692281-33692303 GAAGCTCCAGAAATGAATGGTGG - Intergenic
1040484500 8:47857229-47857251 GCTGCTTCTGAAAACAATGGAGG - Exonic
1042158405 8:65868025-65868047 GTGGCCCCTGCAATGAATGATGG - Intergenic
1043859328 8:85297846-85297868 GCTGCTCCCACAGGGAATGGTGG - Intergenic
1046442037 8:114269401-114269423 GCTGTTCCTGAAATAAATGGGGG + Intergenic
1047209735 8:122831673-122831695 GTGGCCCCTGCAATGAATGATGG + Intronic
1047674547 8:127185853-127185875 GCTTCTCTTGCAATTAATTGTGG - Intergenic
1052275298 9:26668620-26668642 GCTCTTGCTGGAATGAATGGTGG - Intergenic
1052505480 9:29348661-29348683 CCTGCTAATGCAAAGAATGGTGG + Intergenic
1053786311 9:41655160-41655182 GCTGTTCCCGCAAAGAGTGGGGG - Intergenic
1054175024 9:61869104-61869126 GCTGTTCCCGCAAAGAGTGGGGG - Intergenic
1054662513 9:67711689-67711711 GCTGTTCCCGCAAAGAGTGGGGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1056025187 9:82486728-82486750 GCTGCTCCTGAAAGCAATGTAGG + Intergenic
1056939169 9:90940607-90940629 TTTGCTCCTGCACTGAATTGAGG + Intergenic
1061133761 9:128722080-128722102 GCTCCTCCTGGAATGAGGGGTGG + Exonic
1062032003 9:134365977-134365999 GCGGCTCCTGCAAAGACAGGCGG - Intronic
1203531958 Un_GL000213v1:153528-153550 GCTGCTCTTGCAACTAAAGGTGG - Intergenic
1189919472 X:45889205-45889227 CCTGCTCCTGAAAAGACTGGTGG - Intergenic
1191654887 X:63585910-63585932 GCTGCATCTGCAATGATTGTTGG + Intergenic
1192726058 X:73753166-73753188 GCTGCTGCTGCCAGGGATGGGGG + Intergenic
1197819926 X:130531929-130531951 GCTTCCCCTGCAATTCATGGAGG + Intergenic