ID: 901825562

View in Genome Browser
Species Human (GRCh38)
Location 1:11858882-11858904
Sequence GCTGCTGCTGCGATGCGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901825558_901825562 29 Left 901825558 1:11858830-11858852 CCATGTCTCTGGAGGGACTGCGG 0: 1
1: 0
2: 1
3: 14
4: 162
Right 901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG 0: 1
1: 0
2: 2
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901825562 Original CRISPR GCTGCTGCTGCGATGCGTCC GGG Exonic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
900694213 1:4000109-4000131 GCTGCAGCTGCTCTGAGTCCAGG + Intergenic
901513565 1:9730543-9730565 GCTGCTGCCGGGTTGCGTTCTGG + Exonic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902079716 1:13812759-13812781 CCTCCTGCTCCGATGCTTCCTGG + Intronic
902447363 1:16475875-16475897 GCTGCTGCTCCACTGCCTCCTGG + Intergenic
902455963 1:16534373-16534395 GCCGCTGCTGAGAGGCGGCCTGG - Intergenic
902496206 1:16873538-16873560 GCCGCTGCTGAGAGGCGGCCTGG + Intronic
902507368 1:16946919-16946941 GCTGCTGCTCCAATGCCTCCTGG - Exonic
905381006 1:37561600-37561622 GCTGCTGCTGCTGCGAGTCCGGG + Exonic
905410286 1:37763991-37764013 GCTGCTGATCCGATGCCTCCTGG - Intronic
905959877 1:42035250-42035272 GCTGCTGCTGCAGGGCGCCCGGG - Intronic
907523382 1:55039648-55039670 GCTGCTGCAACGACGCGTCCCGG - Exonic
907523968 1:55043077-55043099 GATGCTGGTGCCATGCTTCCTGG + Intronic
908747161 1:67386725-67386747 GCTGTTGCTGCCATGGGTCAGGG + Intronic
911806476 1:102214764-102214786 GCAGATGCTGCCATGCTTCCTGG + Intergenic
912491995 1:110067579-110067601 CCTGCTGCGGCGCTGCTTCCTGG - Intronic
912738832 1:112174799-112174821 GCTGCTGCAGCGATGCTTTATGG - Intergenic
914908146 1:151763398-151763420 GCTGCTTCGGGGAGGCGTCCAGG - Exonic
914950864 1:152112325-152112347 GCTGCTGCTGCTCTTCCTCCTGG + Exonic
915902373 1:159855969-159855991 GCTGCTGCTGCGGGGGCTCCGGG - Exonic
1064000642 10:11661330-11661352 GCTGCTTCTGCTCTGCTTCCTGG - Intergenic
1067015489 10:42754391-42754413 GCTGCGGCTCCGAGGCTTCCAGG - Intergenic
1067039330 10:42940662-42940684 GCTGCGGTTGCGAAGCCTCCTGG + Intergenic
1067225535 10:44373695-44373717 GATGCTGCTGCCCTGCATCCTGG + Intronic
1068954907 10:62813733-62813755 GCTGCTGCTGAGCTGCTACCAGG + Exonic
1075259414 10:120949709-120949731 CCTGCTGCGGAGATGAGTCCAGG - Intergenic
1079721559 11:23820775-23820797 GCTTCTACTGCTATGCTTCCTGG + Intergenic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1080556483 11:33421961-33421983 GCTGCTGCTGCTATTGGTCTGGG + Intergenic
1083308488 11:61772734-61772756 GCTGCAGCTGCCAAGCTTCCTGG - Intronic
1083457284 11:62787396-62787418 GCTGCTGCAGCGGCGCTTCCTGG + Intronic
1084468532 11:69341601-69341623 GGTGCTGCTGCTGTGGGTCCAGG - Intronic
1084650758 11:70487949-70487971 GCTGCTGCTGTGGGGCCTCCAGG + Intronic
1084693318 11:70739386-70739408 GCAGCTGCTGCGGTGAGGCCAGG + Intronic
1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG + Exonic
1091016728 11:132058262-132058284 GCTGCTGCTGGAATGTGTGCTGG + Intronic
1091250471 11:134140054-134140076 CCTGCTGATGCCATGCTTCCAGG - Intronic
1098416879 12:70243868-70243890 GCTGCCGCCGCGCTGCTTCCTGG + Intronic
1100690308 12:97032386-97032408 GATGTTGCTGGGATGCCTCCTGG + Intergenic
1102470753 12:113158585-113158607 GCTGCTGCTTCCATGTGTTCTGG - Exonic
1109962344 13:69646732-69646754 GCAGATGCTGCCATGCTTCCTGG + Intergenic
1113540124 13:111100732-111100754 GCTGCTGCTGCGCTGAGTTCAGG - Intergenic
1119518395 14:75266593-75266615 GCAGCTGCTGCCATGCATCCTGG - Intronic
1121098423 14:91233727-91233749 GCCGCGGCTGCGATGTGGCCAGG - Exonic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1122121922 14:99559091-99559113 GCAGGTGCTGCCATGCTTCCTGG + Intronic
1122688411 14:103520752-103520774 TCTCCTGCTGTGAGGCGTCCCGG - Intronic
1122814660 14:104306589-104306611 GCTGCTTCTGCCATGAGGCCTGG + Intergenic
1125550221 15:40539322-40539344 GCTGCTGCTGCCAGGGGTTCTGG + Intronic
1127289365 15:57556674-57556696 GCTGCTGTTGCTATGGGTCATGG + Intergenic
1128253319 15:66179087-66179109 GCTGGGGCTGTGATGCTTCCCGG - Intronic
1132285835 15:100661649-100661671 GCTGCTGCTACTGTGGGTCCTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1137300236 16:47142935-47142957 GCTGCTGCTCGGGTGCTTCCCGG - Intronic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1139466047 16:67154765-67154787 GCTGCTGCGGCGCTTCGTGCAGG - Exonic
1140723177 16:77788984-77789006 GCTGCGGCTGGGATGCTGCCCGG + Intronic
1140972868 16:80030125-80030147 GCTGCTGATGCTGTGTGTCCAGG - Intergenic
1141661153 16:85442322-85442344 GCTGATGCTGAGATGGGGCCAGG - Intergenic
1142409847 16:89910454-89910476 GCTGCTGCTGCTCTGCCCCCTGG + Intronic
1144732977 17:17539478-17539500 GATGCCTCTGCGATGCGCCCAGG + Intronic
1146214908 17:30971262-30971284 GCGGCTGCTGCGCGGCGCCCTGG - Exonic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147482425 17:40779609-40779631 GCTGCTGCAGCGAGGCGCTCTGG + Exonic
1147970870 17:44218785-44218807 GCGGCGGCTGCGCTGCGTCCGGG - Intronic
1147988593 17:44320226-44320248 GCTGCTGCTGCGGAGGATCCGGG - Exonic
1151755886 17:76075027-76075049 GGTGCTGCTGCGCGGCGGCCAGG + Exonic
1152128682 17:78462782-78462804 GCAGCTCCTGCGAGGCCTCCAGG + Intronic
1152403977 17:80086158-80086180 GCTCCTTCTTGGATGCGTCCAGG - Exonic
1153013796 18:565295-565317 GCTGCTGCTGAGAAGCTTCAGGG + Intergenic
1153513863 18:5886459-5886481 TATGCTGCTGCAATGCCTCCTGG - Exonic
1156088818 18:33440792-33440814 GCTGCTGCTCCGGGGCCTCCTGG + Intronic
1157222735 18:45839046-45839068 GCTGCTGCTGCTCGGGGTCCTGG + Exonic
1157531918 18:48428616-48428638 GCTGCTGCTGTGGTGGGTTCTGG - Intergenic
1157719139 18:49910168-49910190 GCTGCTGCTGTGATGTGCTCAGG - Intronic
1158732856 18:60044913-60044935 GCTGCTGCTCCCCTGTGTCCTGG - Intergenic
1162648327 19:12066010-12066032 GCTGCTGCTCAGGTGGGTCCAGG - Intronic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1163748922 19:19064021-19064043 GCGGCGGCGGCGACGCGTCCGGG + Exonic
1167443685 19:49525064-49525086 GCTGCTGCTGCGGGTCTTCCTGG + Intronic
1167661227 19:50797074-50797096 TCAGCTGCTGAGCTGCGTCCAGG - Intergenic
1167684871 19:50949995-50950017 GCTGCTGCTGTCATCCGACCGGG + Exonic
1202706850 1_KI270713v1_random:30729-30751 GCCGCTGCTGAGAGGCGGCCTGG - Intergenic
926205541 2:10832539-10832561 GCTGCTGCGGGGATGCGTGTGGG + Intronic
927909103 2:26884048-26884070 GCTGCAGCTGCCATCCTTCCAGG + Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
931653397 2:64488808-64488830 GCTGCTGCTGCGATGAGTCTGGG - Intergenic
942392821 2:175513770-175513792 GTTGCTGCTGCTATTGGTCCTGG + Intergenic
942408959 2:175686230-175686252 GGTGCTGCTGTGAGGCGTCAAGG - Intergenic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
946312399 2:218890074-218890096 CCTGTGGCTGTGATGCGTCCCGG + Exonic
947028878 2:225770189-225770211 GCTGCTGCTGCACTGCAGCCAGG + Intergenic
1168795660 20:608968-608990 GCAGCTCCTGCAATGTGTCCTGG - Intronic
1170568889 20:17621929-17621951 GCTGCTTCTCCGATTCCTCCTGG + Exonic
1175910038 20:62400739-62400761 GCTGCAGCTCCTCTGCGTCCTGG - Intronic
1180043912 21:45294090-45294112 GCAGCCGCTGGGATGTGTCCAGG - Intergenic
1180614647 22:17119663-17119685 GCTGGCGCTGCGCTGCCTCCTGG - Exonic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
1183189423 22:36312222-36312244 GCTGATGCTGCGCTTCCTCCAGG - Exonic
1183692757 22:39400057-39400079 GCTGCTGCTGCCGGGCGTCGAGG + Intronic
1184839944 22:47046680-47046702 GCTGCTGCTGTGATGGCGCCTGG + Intronic
1185418267 22:50721427-50721449 GCCGCTGCAGGGATGTGTCCAGG - Intergenic
949571515 3:5298032-5298054 GCTGCTGCTCAGATGTGTGCTGG + Intergenic
952953886 3:38544827-38544849 GCTGCTGCTGTGCTGTTTCCAGG + Intergenic
953237362 3:41118462-41118484 GCAGATGCTGCCATGCTTCCTGG - Intergenic
953460174 3:43075964-43075986 GCTGCTGCTGTGGTGGGACCTGG + Intergenic
957430811 3:80103944-80103966 GCTGCAGCTGAGAAGGGTCCAGG - Intergenic
965690178 3:171347622-171347644 GCTGCTGCTCCGATGACTCCTGG - Intronic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
969462495 4:7336171-7336193 GCTGCCCCTGCCCTGCGTCCTGG + Intronic
969597775 4:8158679-8158701 GCGGCTGCTGAGATGAGTGCAGG - Exonic
971457819 4:26860853-26860875 GCTGCTGCTGCGGCGAGACCGGG - Exonic
974967472 4:68779550-68779572 GCTGCTGCTGCACTGCAGCCTGG - Intergenic
974968299 4:68792446-68792468 GCTGCTGCTGCGCTCCAGCCTGG + Intergenic
985822563 5:2170144-2170166 GGGGCTGCTGCGAGGCGGCCTGG - Intergenic
990399625 5:55425076-55425098 TCTGCTGCTGCTATGCCTCTTGG - Exonic
992747234 5:79831671-79831693 GCTGCTGCAGCCATGAGTCAGGG + Intergenic
994318370 5:98360695-98360717 GCAGCTGCTGGGATGTGGCCTGG + Intergenic
997298603 5:132785654-132785676 GCTGCTGCTGGGAGGAATCCAGG + Intronic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
997580514 5:135013931-135013953 GCAGGTGCTGCCATGCCTCCTGG - Intergenic
1001934898 5:175696883-175696905 GCTCCTGCTGCACTGCGGCCCGG - Intergenic
1002697493 5:181100677-181100699 GGTGCTGCGGCGCGGCGTCCCGG + Intergenic
1006300154 6:33189644-33189666 GCTGATGCTGCCCTGCCTCCAGG - Intronic
1007162398 6:39802078-39802100 GCTGCTAGTGCAATGCTTCCTGG - Intronic
1010969476 6:82248113-82248135 GCTTCTGCTGCGTAGCGACCGGG - Intergenic
1016254507 6:142088364-142088386 GCTGCTGCTCACCTGCGTCCCGG - Exonic
1018424864 6:163671276-163671298 GCTGCTCCTGCGTGGCCTCCAGG + Intergenic
1019282491 7:207521-207543 GCTGCTCCTGAGCTGCGCCCAGG + Intronic
1019618722 7:1979162-1979184 GCTGCTGCCGCGGGGGGTCCAGG + Intronic
1020085430 7:5307763-5307785 GCTGCTGCTGCGTGGGGGCCCGG - Exonic
1020427577 7:8086454-8086476 GCTGCTGCTGGGATGGCTGCTGG - Exonic
1020778727 7:12491493-12491515 GCTGCTTCTGGGAAGCGTTCTGG + Intergenic
1023387749 7:39677119-39677141 GGTGCTTCTGTGATGCGGCCAGG + Intronic
1024984256 7:55181948-55181970 GCTGCTGCTGCTATGTGGCTGGG + Intronic
1028023971 7:85813519-85813541 GCTGCTCCAGCCATGCTTCCTGG - Intergenic
1032854594 7:135823921-135823943 GATGCTGCTGCTGTGGGTCCAGG + Intergenic
1034346482 7:150388447-150388469 GCTGATGCTGGGAGGCCTCCAGG + Exonic
1034462291 7:151204616-151204638 GCGGCTGCTGCGACGCCTGCTGG - Exonic
1035016624 7:155772232-155772254 GCTGCTGCAGCCGTGCCTCCGGG - Intronic
1037666230 8:20972525-20972547 GCTGAGGCTGCGATGGGTCCAGG + Intergenic
1039988421 8:42467512-42467534 GCTGCTGCTGCCAGGCAACCAGG - Intronic
1042458260 8:69030786-69030808 GCAGCTGCTGCCATGCTCCCAGG + Intergenic
1047510913 8:125514654-125514676 CCTGATGCTGCCATGGGTCCAGG - Intergenic
1056798467 9:89675144-89675166 GCTGCTGATGGGAGGAGTCCTGG + Intergenic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1060775561 9:126371332-126371354 GTACCTGCTGCGATGCGGCCAGG + Intronic
1061449336 9:130660107-130660129 GCCGGTGCTGCGCTCCGTCCTGG - Intergenic
1062495563 9:136830003-136830025 GCTGGGGCTCCGGTGCGTCCTGG - Intronic
1187966211 X:24614931-24614953 GCTGCTGCTGCTACTAGTCCTGG - Intronic
1189408677 X:40749774-40749796 GCTGCTGCTGAGATGGCTCAGGG - Intergenic
1189899330 X:45689740-45689762 GATGCTGGTGCCATGCTTCCTGG + Intergenic
1196856750 X:119991530-119991552 GCTGCTGCTGCGAGGGCTCCTGG - Intergenic
1196857696 X:119999581-119999603 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1196859591 X:120014929-120014951 GCTGCTGCTGCCAGGGCTCCTGG + Intergenic
1198509135 X:137331493-137331515 GCTGCTGCTGTTATAAGTCCTGG - Intergenic
1201468881 Y:14313159-14313181 GGTGCTGCTGCAGGGCGTCCAGG - Intergenic
1201515485 Y:14815352-14815374 GATGCTGCTGCAAGGGGTCCAGG + Intronic